| Friday, October 8th, 2010, 00:01 UTC | ||
| [00:01:41] | Saviq: | kormoc: a) lighttpd2 is unusable atm b) apache with mod_php helped |
| [00:01:50] | Saviq: | kormoc: and the double slash comes from http://svn.mythtv.org/trac/browser/trunk/myth . . . nes.php#L142 line 142 |
| [00:02:22] | jya (jya!~avenardj@gw2.hydrix.com) has joined #mythtv-users | |
| [00:02:38] | ttelford (ttelford!~quassel@nat/sgi/x-gnnfauooxwjivtta) has quit (Read error: Connection reset by peer) | |
| [00:02:54] | ttelford (ttelford!~quassel@nat/sgi/x-ddmfzdvwzegvyzxg) has joined #mythtv-users | |
| [00:02:56] | Saviq: | not that it makes a difference, but still ;) |
| [00:06:57] | drindt (drindt!~drindt@89.204.137.65) has quit (Quit: Mary had a little Segmentation fault) | |
| [00:08:09] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has quit (Ping timeout: 265 seconds) | |
| [00:13:23] | abqjp (abqjp!~abqjp@97-119-165-177.albq.qwest.net) has quit (Quit: abqjp) | |
| [00:18:04] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [00:22:20] | Saviq is now known as Saviq_afk | |
| [00:27:32] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Quit: hadees) | |
| [00:27:57] | troyt (troyt!~quassel@nat/sgi/x-pucqepxdhtounceu) has quit (Remote host closed the connection) | |
| [00:31:50] | troyt (troyt!~quassel@nat/sgi/x-vpsnsqhyspygmuuj) has joined #mythtv-users | |
| [00:40:40] | darkdrgn2k3: | hey |
| [00:40:48] | darkdrgn2k3: | does myth have any soundeffects in its ui? |
| [00:41:50] | wagnerrp: | no |
| [00:43:11] | darkdrgn2k3: | ok on a more serious note |
| [00:43:19] | darkdrgn2k3: | any reaons fast warwarding would be "lagged" |
| [00:43:26] | wagnerrp: | lagged? |
| [00:43:32] | darkdrgn2k3: | ie from the time you push the button to the time it actually starts fast forwarding |
| [00:43:46] | darkdrgn2k3: | this time it was a DVD ISO |
| [00:43:48] | darkdrgn2k3: | trunk |
| [00:47:07] | dmz (dmz!~dmz@64.203.207.101.dyn-cm-pool-54.hargray.net) has quit (Quit: Ex-Chat) | |
| [00:47:11] | zmd (zmd!~dmz@64.203.207.101.dyn-cm-pool-54.hargray.net) has joined #mythtv-users | |
| [00:47:18] | zmd is now known as dmz | |
| [00:57:03] | darkdrgn2k3: | any one know what directories mythtv writes to ? |
| [00:57:46] | wagnerrp: | where ever you tell it to, plus ~/.mythtv/ |
| [00:58:25] | darkdrgn2k3: | ok cause i got a CF harddrive in a fe. |
| [00:58:38] | darkdrgn2k3: | if i ramdisk /var/log /tmp and ~/ |
| [00:58:44] | darkdrgn2k3: | that should speed up access right? |
| [01:00:38] | wagnerrp: | not likely |
| [01:01:26] | darkdrgn2k3: | but cf is so slow to write |
| [01:01:45] | pizzledizzle (pizzledizzle!~pizdets@pool-96-250-215-244.nycmny.fios.verizon.net) has quit () | |
| [01:01:47] | wagnerrp: | the only thing that gets written is your theme cache |
| [01:01:50] | Beirdo: | so don't use it |
| [01:01:51] | wagnerrp: | and that is only written once |
| [01:02:17] | darkdrgn2k3: | Beirdo: hd takes up more power |
| [01:02:22] | darkdrgn2k3: | wagnerrp: good point.. |
| [01:02:26] | wagnerrp: | well this is great... |
| [01:02:30] | darkdrgn2k3: | wagnerrp: anything else get written often? |
| [01:02:31] | Beirdo: | wah wah :) hehe |
| [01:02:39] | wagnerrp: | trying to correct some misconceptions about the python bindings on the xbmc forums |
| [01:02:54] | wagnerrp: | but maildrop seems to have eaten my authentication email |
| [01:03:05] | wagnerrp: | and i cant seem to get it to resend |
| [01:04:21] | darkdrgn2k3: | ... why des xbmc always seem to have a nicer interface the myth :-P |
| [01:04:47] | wagnerrp: | developer count |
| [01:05:03] | darkdrgn2k3: | LOL true.. |
| [01:05:06] | darkdrgn2k3: | again |
| [01:05:07] | Beirdo: | ? |
| [01:05:13] | Beirdo: | developer count? |
| [01:05:32] | wagnerrp: | dont they have several dozen? versus our 10 or so active |
| [01:05:55] | Beirdo: | quantity != quality :) |
| [01:06:15] | darkdrgn2k3: | xbcm doesnt have a good distributed device system though.. or am i mistaken |
| [01:06:28] | wagnerrp: | fair enough, but our UI was effectively written by one person |
| [01:06:53] | Beirdo: | yeah, true |
| [01:07:24] | Beirdo: | of course, the best interface in the world doesn't fix bugs in the core :) |
| [01:07:25] | Beirdo: | hehe |
| [01:08:07] | darkdrgn2k3: | to be honest.. i would LOVE to see a video galary UI like the wii USB LOADER |
| [01:08:19] | Beirdo: | get writin it |
| [01:08:27] | wagnerrp: | darkdrgn2k3: doesnt mythvideo have one of those? |
| [01:08:53] | wagnerrp: | i dont get it... my maildroprc should have everything fall through to the base folder |
| [01:08:59] | darkdrgn2k3: | closes is iamlindo's first theme.. but its sufferes from a OPENGL bug |
| [01:09:03] | wagnerrp: | i dont see anywhere that would cause emails to simply be dropped |
| [01:09:16] | wagnerrp: | darkdrgn2k3: no, i mean the gallery view, even on the old UI |
| [01:09:23] | wagnerrp: | had a 2D matrix of videos |
| [01:09:38] | wagnerrp: | and if you enabled the cursor, it would act exactly like the gallery on the wii |
| [01:09:40] | darkdrgn2k3: | wagnerrp: but it SOO SLOOW to scroll through all the movies :( |
| [01:10:01] | wagnerrp: | i dont see how a page at a time could be any faster |
| [01:10:08] | wagnerrp: | unless you want to jump to a letter or something |
| [01:10:13] | kormoc: | not slow here |
| [01:10:16] | wagnerrp: | last i checked, the wii required you to flip between pages |
| [01:10:20] | darkdrgn2k3: | http://www.amisha-tech.de/images/USB-Loader-G . . . ndchrome.jpg |
| [01:10:20] | kormoc: | perhaps if you didn't buy crappy hardware... |
| [01:10:38] | wagnerrp: | so... youre not talking about the wii |
| [01:10:39] | darkdrgn2k3: | AMD Athlon(tm) II X4 620 Processor |
| [01:10:44] | wagnerrp: | youre talking about some hacked program on the wii |
| [01:10:58] | wagnerrp: | IMHO, that looks ugly |
| [01:10:59] | darkdrgn2k3: | wagnerrp: im talking about EXACLY what i said the wii "USB LOADER" |
| [01:11:07] | kormoc: | bah |
| [01:11:11] | kormoc: | darkdrgn2k3, patches welcome |
| [01:11:15] | kormoc: | 'nuff said |
| [01:11:27] | darkdrgn2k3: | kormoc: i know. i really wanted to jump into dev but i really have had no time to learn QT |
| [01:11:50] | kormoc: | that's what everyone says as they wonder why we don't do exactly what they want |
| [01:12:09] | darkdrgn2k3: | kormoc: im not demanding anything.. saying it be cool :) not saying "DO IT" |
| [01:12:24] | Beirdo: | Qt isn't THAT hard |
| [01:12:44] | darkdrgn2k3: | Beirdo: i know.. sure beet MOFFIX or whatever that was that i used to do long time aggo |
| [01:13:05] | darkdrgn2k3: | kormoc: honeslty i woudl LOVE to jump back into C..... i just have no time to sleep :( im hopeing things will settle down at work so i can get back into it |
| [01:13:59] | darkdrgn2k3: | anyway as for krap hardware im running a AMD Athlon(tm) II X4 620 Processor |
| [01:14:11] | darkdrgn2k3: | only 2 gigs of ram though :( |
| [01:14:22] | Beirdo: | so I see. Hardware = only processor now? |
| [01:14:38] | abqjp (abqjp!~abqjp@174-28-188-79.albq.qwest.net) has joined #mythtv-users | |
| [01:15:05] | darkdrgn2k3: | Beirdo: what do you consider hardware? |
| [01:15:22] | Beirdo: | more than just a processor |
| [01:15:31] | darkdrgn2k3: | what would oyu like to know |
| [01:15:39] | Beirdo: | especially when you are talking about things that require OpenGL. |
| [01:15:44] | darkdrgn2k3: | ooo |
| [01:15:58] | darkdrgn2k3: | nVidia Corporation MCP78S [GeForce 8200] Memory Controller (rev a2) :) |
| [01:16:01] | FredYerkes (FredYerkes!~fyerkes@99-6-102-81.lightspeed.milwwi.sbcglobal.net) has joined #mythtv-users | |
| [01:16:03] | darkdrgn2k3: | oops |
| [01:16:12] | darkdrgn2k3: | VGA compatible controller: nVidia Corporation GeForce 8200 (rev a2) |
| [01:16:57] | darkdrgn2k3: | ASUSTeK Computer INC. M3N78-VM 2gig ram AMD Athlon(tm) II X4 620 Processor nVidia 8200 |
| [01:17:09] | darkdrgn2k3: | SATA drives |
| [01:17:23] | darkdrgn2k3: | what more can i provide you with :-P |
| [01:17:34] | Beirdo: | code |
| [01:17:35] | Beirdo: | heh |
| [01:17:44] | kormoc: | your full name, address, social security number, date of birth, yearly income... |
| [01:17:48] | darkdrgn2k3: | void helloWorld() { return; } |
| [01:18:10] | Beirdo: | oh, and credit card numbers, expiry dates and Conf. codes |
| [01:18:20] | Beirdo: | heh |
| [01:18:20] | kormoc: | hair samples for dna extraction |
| [01:18:32] | darkdrgn2k3: | Bill Gates, 1 Microsoft Way, 512-332–654, Oct 28, 1955 1.5 Billion dolars |
| [01:18:47] | Beirdo: | nice try |
| [01:18:49] | darkdrgn2k3: | ... 45193234554321665 11/12 |
| [01:18:50] | darkdrgn2k3: | 4467 |
| [01:19:21] | darkdrgn2k3: | ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGT GGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTG GTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAG GCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAA TAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAA |
| [01:19:28] | darkdrgn2k3: | anything else :-P |
| [01:19:36] | kormoc: | 4111-1111-1111–1111 12/99 999 |
| [01:19:41] | kormoc: | perfectly valid visa number |
| [01:19:49] | darkdrgn2k3: | yeh the testing # |
| [01:20:00] | wagnerrp: | that says... you have, a third nipple? |
| [01:20:14] | darkdrgn2k3: | 4th actualy.. |
| [01:20:19] | kormoc: | good way to make a living as a fortune teller |
| [01:20:23] | darkdrgn2k3: | and if anyone cares : http://www.beachnet.com/~hstiles/cardtype.html |
| [01:22:21] | darkdrgn2k3: | seriosuly though thats a 1/2 decent puter right |
| [01:47:31] | FredYerkes (FredYerkes!~fyerkes@99-6-102-81.lightspeed.milwwi.sbcglobal.net) has quit (Ping timeout: 240 seconds) | |
| [01:51:39] | devinheitmueller (devinheitmueller!~devin@c-71-205-242-159.hsd1.mi.comcast.net) has joined #mythtv-users | |
| [02:01:09] | fleers (fleers!~fleers@cpe-76-93-149-51.san.res.rr.com) has joined #mythtv-users | |
| [02:01:41] | [R] ([R]!~rbox@unaffiliated/rbox) has joined #mythtv-users | |
| [02:02:25] | troyt (troyt!~quassel@nat/sgi/x-vpsnsqhyspygmuuj) has quit (Remote host closed the connection) | |
| [02:06:54] | troyt (troyt!~quassel@nat/sgi/x-cvuhjikumxnwnwyk) has joined #mythtv-users | |
| [02:11:00] | NightMonkey (NightMonkey!~NightMonk@pdpc/supporter/professional/nightmonkey) has joined #mythtv-users | |
| [02:26:24] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has joined #mythtv-users | |
| [02:31:13] | pyther (pyther!~pyther@unaffiliated/pyther) has quit (Ping timeout: 265 seconds) | |
| [02:31:36] | RMind (RMind!~Blah@71-13-209-7.dhcp.mrqt.mi.charter.com) has joined #mythtv-users | |
| [02:34:18] | RagingMind (RagingMind!~Blah@71-13-209-7.dhcp.mrqt.mi.charter.com) has quit (Ping timeout: 240 seconds) | |
| [02:35:07] | abqjp (abqjp!~abqjp@174-28-188-79.albq.qwest.net) has quit (Quit: abqjp) | |
| [02:35:12] | RMind (RMind!~Blah@71-13-209-7.dhcp.mrqt.mi.charter.com) has quit (Client Quit) | |
| [02:35:53] | abqjp (abqjp!~abqjp@174-28-188-79.albq.qwest.net) has joined #mythtv-users | |
| [02:39:48] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [02:45:14] | abqjp (abqjp!~abqjp@174-28-188-79.albq.qwest.net) has quit (Quit: abqjp) | |
| [02:50:04] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Quit: hadees) | |
| [02:50:05] | devinheitmueller (devinheitmueller!~devin@c-71-205-242-159.hsd1.mi.comcast.net) has left #mythtv-users () | |
| [03:01:03] | Beirdo: | woohoo. [26700] is MINE |
| [03:01:34] | wagnerrp: | the day is mine! |
| [03:01:36] | Dipak (Dipak!4a6999a0@gateway/web/freenode/ip.74.105.153.160) has joined #mythtv-users | |
| [03:01:45] | [R]: | victory is mine! |
| [03:02:44] | Dipak (Dipak!4a6999a0@gateway/web/freenode/ip.74.105.153.160) has quit (Client Quit) | |
| [03:03:29] | wagnerrp: | ohhh, i'll play your game, you rogue! |
| [03:04:58] | [R]: | is there some hidden reference? |
| [03:05:57] | wagnerrp: | whats the difference between you and a mallard with a cold? |
| [03:06:12] | [R]: | what? |
| [03:06:36] | wagnerrp: | one's a sick duck and i can't remember how it ends but your mother's a whore |
| [03:06:55] | simcop2387_ (simcop2387_!~simcop238@p3m/member/simcop2387) has joined #mythtv-users | |
| [03:06:55] | simcop2387 (simcop2387!~simcop238@p3m/member/simcop2387) has joined #mythtv-users | |
| [03:07:00] | simcop2387 (simcop2387!~simcop238@p3m/member/simcop2387) has quit (Read error: Connection reset by peer) | |
| [03:07:06] | simcop2387_ (simcop2387_!~simcop238@p3m/member/simcop2387) has quit (Remote host closed the connection) | |
| [03:08:05] | [R]: | lol |
| [03:10:36] | wagnerrp: | you'll rue the day you crossed me [R] |
| [03:10:48] | simcop2387 (simcop2387!~simcop238@p3m/member/simcop2387) has joined #mythtv-users | |
| [03:10:53] | simcop2387_ (simcop2387_!~simcop238@p3m/member/simcop2387) has joined #mythtv-users | |
| [03:11:00] | simcop2387_ (simcop2387_!~simcop238@p3m/member/simcop2387) has quit (Read error: Connection reset by peer) | |
| [03:12:18] | Beirdo: | wagnerrp: oO. So not channel friendly :) |
| [03:12:42] | wagnerrp: | we meet again, you logger headed tickle brain poppycock! |
| [03:13:01] | Beirdo: | snicker |
| [03:14:28] | ** wagnerrp stops reading through celebrity jeopardy transcripts ** | |
| [03:14:49] | [R]: | rough... just the way your mother likes it |
| [03:15:36] | [R] ([R]!~rbox@unaffiliated/rbox) has quit (Quit: Leaving) | |
| [03:20:30] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [03:20:40] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Client Quit) | |
| [03:26:46] | Beirdo: | coool... gout medication... with a common side effect of... gout flares |
| [03:27:02] | Beirdo: | the pharmaceutical companies are insane |
| [03:27:40] | wagnerrp: | the gout is going to occasionally flare up without it, right? |
| [03:27:53] | Beirdo: | I would assume so |
| [03:27:58] | wagnerrp: | why not just say... 'the medication is not always effective' |
| [03:28:14] | Beirdo: | but causing the exact symptom you are supposed to treat... insane :) |
| [03:28:15] | Beirdo: | yeah |
| [03:28:42] | wagnerrp: | you think there is actual proof its causing the symptom? |
| [03:28:53] | wagnerrp: | or are they just covering themselves in case it doesnt work as intended |
| [03:28:57] | Beirdo: | they say it's a side effect. |
| [03:29:09] | Beirdo: | caution... could make it worse |
| [03:29:16] | Beirdo: | yeah, I'll go with THAT drug |
| [03:29:54] | Beirdo: | just make sure you give me a bottle that ISN'T just sugar pills, please |
| [03:29:59] | Beirdo: | stupid ads :) |
| [03:33:53] | dashcloud (dashcloud!~quassel@pool-173-49-209-160.phlapa.fios.verizon.net) has quit (Ping timeout: 245 seconds) | |
| [03:35:59] | wagnerrp: | you know, xbmc is all gung-ho python |
| [03:36:07] | wagnerrp: | they have a widely used python interface for python |
| [03:36:08] | GreyFoxx: | 28015qzg |
| [03:36:14] | wagnerrp: | why do their people all use bash? |
| [03:36:25] | wagnerrp: | and why doesnt GreyFoxx just get a keyboard guard |
| [03:36:38] | wagnerrp: | or maybe lock his computer |
| [03:36:59] | ** wagnerrp shoos away GreyFoxx's cats ** | |
| [03:38:30] | Beirdo: | heheh |
| [03:38:58] | Beirdo: | how's your ZFS behaving tonight? got that worked out? |
| [03:39:41] | wagnerrp: | got the root all migrated over, the old hardware mirror removed, and my big hardware raid6 is sitting one drive down |
| [03:39:47] | wagnerrp: | hopefully the replacement will be in tomorrow |
| [03:40:06] | Beirdo: | nice |
| [03:40:08] | wagnerrp: | about to pull the recordings off my last drive currently |
| [03:40:19] | wagnerrp: | just plugged it into the system with a usb-->pata box |
| [03:40:33] | Beirdo: | hehe, those things are so handy |
| [03:41:10] | Beirdo: | especially since USB2.0 became widespread |
| [03:42:51] | wagnerrp: | silly USB2.0 |
| [03:43:09] | Beirdo: | a lot better than 1.1 |
| [03:43:42] | wagnerrp: | i can watch the interface usage, and it sits there reading for several seconds at 10MB/s, and then spams the buffer over to the SATA drive at >100MB/s |
| [03:44:56] | deegan_ (deegan_!~deegan@88.83.55.163) has joined #mythtv-users | |
| [03:45:10] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [03:45:15] | Beirdo: | heh |
| [03:49:05] | deegan (deegan!~deegan@88.83.55.139) has quit (Ping timeout: 276 seconds) | |
| [03:50:07] | wagnerrp: | still need to fix disk mounting on the SBE |
| [03:50:22] | wagnerrp: | i forgot to add enough disk device nodes for where they should show up |
| [03:51:03] | Beirdo: | so... the ESATA port on the back of my backend box SHOULD have PMP support |
| [03:51:08] | Beirdo: | yay |
| [03:51:34] | wagnerrp: | PMP? |
| [03:51:49] | Beirdo: | port multiplier |
| [03:52:31] | wagnerrp: | thinking of stacking another box on top of it? |
| [03:52:33] | Beirdo: | as does the MiniPCIE one |
| [03:53:01] | Beirdo: | as future expandability, one of the 5-bay boxes or something could be useful |
| [03:53:49] | wagnerrp: | 10MB/s, 110GB... this is going to take some time |
| [03:53:56] | Beirdo: | yup |
| [03:54:08] | Beirdo: | put yer feet up and watch some TV |
| [03:54:27] | wagnerrp: | 3 hrs |
| [03:55:49] | Beirdo: | whoah |
| [03:55:58] | Beirdo: | the new drives... run nice and cool |
| [03:56:20] | Beirdo: | the 3 I have as SG drives are all at 34–35C |
| [03:56:29] | Beirdo: | the two system drives... 26C |
| [03:57:31] | wagnerrp: | what brand? |
| [03:57:42] | Beirdo: | Seagate. All 5 drives |
| [03:57:54] | Beirdo: | ST3250318AS: |
| [03:58:04] | Beirdo: | s/:$// |
| [03:58:14] | Beirdo: | that's the new system drives |
| [03:58:27] | wagnerrp: | mine are all very hot |
| [03:58:46] | wagnerrp: | my samsungs are all 6–7C cooler than the seagates and WDs |
| [03:58:50] | deegan_ (deegan_!~deegan@88.83.55.163) has quit (Ping timeout: 276 seconds) | |
| [03:58:56] | Beirdo: | mine have a HUGE fan blowing across tehm |
| [03:59:07] | deegan_ (deegan_!~deegan@88.83.55.139) has joined #mythtv-users | |
| [03:59:14] | Beirdo: | 180mm, I think |
| [03:59:37] | wagnerrp: | yeah, ive only got 80mms sitting behind mine |
| [04:00:04] | wagnerrp: | but 180? i dont think your case is that wide |
| [04:00:05] | Beirdo: | I think that was the size |
| [04:00:11] | Beirdo: | huge |
| [04:00:27] | Beirdo: | one sec |
| [04:01:39] | Beirdo: | sorry |
| [04:01:41] | Beirdo: | 140mm |
| [04:01:50] | Beirdo: | huge anyways |
| [04:01:51] | Beirdo: | heh |
| [04:02:17] | joat (joat!~joat@ip70-174-79-200.hr.hr.cox.net) has joined #mythtv-users | |
| [04:03:01] | Beirdo: | 180mm would fit though |
| [04:03:30] | Beirdo: | that's only 7" |
| [04:03:39] | Beirdo: | the case is 9" wide :) |
| [04:06:17] | joat (joat!~joat@ip70-174-79-200.hr.hr.cox.net) has left #mythtv-users () | |
| [04:18:27] | Saviq_afk is now known as Saviq | |
| [04:26:05] | Saviq is now known as Saviq_afk | |
| [04:26:29] | And4713 (And4713!~And4713@c-98-201-146-20.hsd1.tx.comcast.net) has quit (Remote host closed the connection) | |
| [04:43:17] | [R] ([R]!~rbox@unaffiliated/rbox) has joined #mythtv-users | |
| [04:44:02] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has quit (Ping timeout: 255 seconds) | |
| [04:54:53] | deegan__ (deegan__!~deegan@88.83.55.163) has joined #mythtv-users | |
| [04:56:25] | [R] ([R]!~rbox@unaffiliated/rbox) has quit (Quit: Leaving) | |
| [04:59:17] | deegan_ (deegan_!~deegan@88.83.55.139) has quit (Ping timeout: 276 seconds) | |
| [05:09:02] | deegan__ (deegan__!~deegan@88.83.55.163) has quit (Ping timeout: 276 seconds) | |
| [05:09:20] | deegan__ (deegan__!~deegan@88.83.55.139) has joined #mythtv-users | |
| [05:39:18] | NightMonkey (NightMonkey!~NightMonk@pdpc/supporter/professional/nightmonkey) has quit (Ping timeout: 240 seconds) | |
| [05:42:21] | hpeter (hpeter!~hpeter@178-83-237-229.dclient.hispeed.ch) has joined #mythtv-users | |
| [05:53:03] | vezza (vezza!~andrea@host80-45-dynamic.17-87-r.retail.telecomitalia.it) has joined #mythtv-users | |
| [05:54:24] | NightMonkey (NightMonkey!~NightMonk@pdpc/supporter/professional/nightmonkey) has joined #mythtv-users | |
| [05:55:30] | stoffel (stoffel!~quassel@p57B4CE21.dip.t-dialin.net) has joined #mythtv-users | |
| [05:55:30] | Mode for #mythtv-users by ChanServ!ChanServ@services. : +v stoffel | |
| [05:57:09] | KraMer (KraMer!~mark@adsl-70-240-190-175.dsl.hstntx.swbell.net) has left #mythtv-users ("Leaving") | |
| [06:01:12] | [R] ([R]!~rbox@unaffiliated/rbox) has joined #mythtv-users | |
| [06:03:31] | weta (weta!~aross@CPE485b390978ce-CM00222ddf42dd.cpe.net.cable.rogers.com) has quit (Ping timeout: 240 seconds) | |
| [06:06:35] | hpeter (hpeter!~hpeter@178-83-237-229.dclient.hispeed.ch) has quit (Quit: hpeter) | |
| [06:09:36] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Quit: hadees) | |
| [06:09:48] | weta (weta!~aross@CPE485b390978ce-CM00222ddf42dd.cpe.net.cable.rogers.com) has joined #mythtv-users | |
| [06:10:52] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has joined #mythtv-users | |
| [06:15:38] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has quit (Ping timeout: 240 seconds) | |
| [06:16:06] | christ` (christ`!~Billybob@CPE00e04b0b7799-CM00111a59bdac.cpe.net.cable.rogers.com) has quit (Ping timeout: 240 seconds) | |
| [06:18:19] | christ` (christ`!~Billybob@CPE00e04b0b7799-CM00111a59bdac.cpe.net.cable.rogers.com) has joined #mythtv-users | |
| [06:21:25] | _totalann is now known as totalanni | |
| [06:21:26] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [06:26:27] | zzztrumee is now known as trumee | |
| [06:29:53] | stoffel (stoffel!~quassel@p57B4CE21.dip.t-dialin.net) has quit (Remote host closed the connection) | |
| [06:30:42] | trumee (trumee!~nobody@cpc5-cmbg14-0-0-cust982.5-4.cable.virginmedia.com) has quit (Remote host closed the connection) | |
| [06:35:17] | Beirdo: | where is everyone? :) |
| [06:35:34] | wagnerrp: | hiding |
| [06:35:42] | wagnerrp: | havent you finished counting yet? |
| [06:35:48] | [R]: | what does everyone think of outsourced? |
| [06:36:07] | Beirdo: | [R]: interesting enough |
| [06:37:36] | [R]: | i could never go to india |
| [06:37:58] | Beirdo: | I could... that show is stereotype after lame stereotype |
| [06:38:11] | Beirdo: | but fun to watch... kinda like a train wreck |
| [06:38:18] | Beirdo: | just can't stop |
| [06:38:19] | [R]: | haven't you ever watched amazing race? |
| [06:38:24] | [R]: | india is super scary |
| [06:38:24] | Beirdo: | heck no |
| [06:38:41] | Beirdo: | I don't watch that crap |
| [06:38:53] | Beirdo: | and India's no more scary than... Detroit |
| [06:39:07] | [R]: | you'll get shot in detroit |
| [06:39:09] | wagnerrp: | i would never go to detroit |
| [06:39:14] | [R]: | i dont think theres much gun violence in india |
| [06:39:21] | wagnerrp: | that place is scary |
| [06:39:45] | Beirdo: | Detroit's an unfortunate craphole between Canada and Toledo |
| [06:39:46] | Beirdo: | hehe |
| [06:39:57] | ** Beirdo has cousins in Toledo ** | |
| [06:39:59] | wagnerrp: | what do you call toledo? |
| [06:40:15] | Beirdo: | a slightly less unfortunate craphole |
| [06:40:27] | Beirdo: | actually, technically, they live in Sylvania :) |
| [06:40:39] | [R]: | they live in a television? |
| [06:41:06] | Beirdo: | silly box-boy |
| [06:41:45] | Beirdo: | and got friends in Columbus (and cousins), and in Akron |
| [06:41:54] | Beirdo: | too much oHIo in my family |
| [06:41:55] | Beirdo: | heh |
| [06:42:00] | [R]: | i've been to dayton |
| [06:42:09] | mzb (mzb!~mzb@ppp108-88.static.internode.on.net) has quit (Read error: Connection reset by peer) | |
| [06:42:50] | [R]: | getting my start early/start late numbers just right is tricky |
| [06:43:24] | ** Beirdo slaps his frontend ** | |
| [06:43:40] | Beirdo: | stop with the "waited 100ms for video buffers" crap |
| [06:43:52] | mzb (mzb!~mzb@ppp108-88.static.internode.on.net) has joined #mythtv-users | |
| [06:44:14] | [R] ([R]!~rbox@unaffiliated/rbox) has quit (Quit: Leaving) | |
| [06:44:33] | johd (johd!~johd@90.146.55.47) has joined #mythtv-users | |
| [06:47:15] | mzb (mzb!~mzb@ppp108-88.static.internode.on.net) has quit (Remote host closed the connection) | |
| [06:47:35] | ugliefrog (ugliefrog!~ugliefrog@ip72-198-82-32.ok.ok.cox.net) has joined #mythtv-users | |
| [06:48:55] | ugliefrog: | Im using ubuntu and im looking for a program to extract recordings from my library |
| [06:49:12] | wagnerrp: | extract recordings? |
| [06:49:59] | mzb (mzb!~mzb@ppp108-88.static.internode.on.net) has joined #mythtv-users | |
| [06:51:01] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Quit: hadees) | |
| [06:51:47] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [06:54:01] | ugliefrog: | wagnerrp, lets see maybe the wrong term...give me a sec |
| [06:54:57] | deegan___ (deegan___!~deegan@88.83.55.163) has joined #mythtv-users | |
| [06:55:19] | mcl0vin (mcl0vin!~piper69@69.155.81.25) has quit (Quit: ChatZilla 0.9.86 [Firefox 3.6.10/20100914125854]) | |
| [06:56:13] | ugliefrog: | i think i found what im looking for..its called mythexport....something about perl....anyone use this |
| [06:56:43] | wagnerrp: | mythexport is a web application, for exporting recordings to mobile/embedded devices |
| [06:57:12] | superdump (superdump!~rob@unaffiliated/superdump) has joined #mythtv-users | |
| [06:57:40] | ugliefrog: | export recordings is what im looking for |
| [06:58:53] | deegan__ (deegan__!~deegan@88.83.55.139) has quit (Ping timeout: 276 seconds) | |
| [06:59:11] | ugliefrog (ugliefrog!~ugliefrog@ip72-198-82-32.ok.ok.cox.net) has left #mythtv-users ("Leaving") | |
| [06:59:47] | mzb is now known as zz_mzb | |
| [06:59:55] | zz_mzb is now known as mzb | |
| [07:00:04] | mzb is now known as mzb_zz | |
| [07:00:12] | mzb_zz is now known as mzb | |
| [07:09:17] | deegan___ (deegan___!~deegan@88.83.55.163) has quit (Ping timeout: 276 seconds) | |
| [07:09:34] | deegan___ (deegan___!~deegan@88.83.55.139) has joined #mythtv-users | |
| [07:14:13] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has joined #mythtv-users | |
| [07:20:20] | jovox_ (jovox_!~jovox_@c-b21cf350-74736162.cust.telenor.se) has joined #mythtv-users | |
| [07:27:38] | johd (johd!~johd@90.146.55.47) has quit (Ping timeout: 240 seconds) | |
| [07:30:31] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Quit: hadees) | |
| [07:30:53] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [07:35:07] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Ping timeout: 252 seconds) | |
| [07:37:02] | at0m (at0m!~at0m@94-225-90-23.access.telenet.be) has quit (Quit: RAM upgrades \o/) | |
| [07:43:18] | superdump (superdump!~rob@unaffiliated/superdump) has quit (Ping timeout: 240 seconds) | |
| [07:59:42] | superdump (superdump!~rob@unaffiliated/superdump) has joined #mythtv-users | |
| [08:04:42] | Peitolm: | o.k., that's the first time i've seen mythtv die with this 'terminate called after throwing an instance of 'std::bad_alloc' |
| [08:05:03] | NightMonkey (NightMonkey!~NightMonk@pdpc/supporter/professional/nightmonkey) has quit (Quit: Body blow! Body blow!) | |
| [08:05:09] | justinh: | heh. Sky are apparently now using open source software on their STBs |
| [08:05:44] | justinh: | or – probably more accurately – their boxes have always run a linux kernel & now they're disclosing the fact |
| [08:06:26] | justinh: | Xfree86 ?! :-O |
| [08:06:40] | justinh: | FreeBSD file management software |
| [08:06:57] | justinh: | Components of PP daemon software |
| [08:07:16] | justinh: | and more.. http://www1.sky.com/opensourcesoftware/SkyHD/ . . . License.html |
| [08:07:41] | justinh: | hahaha looks like they've been served |
| [08:07:42] | Peitolm: | they run it in conjunction with OpenTV, which runs on an RT os called nucleous aparently |
| [08:07:55] | justinh: | nucleus. we used to use it here |
| [08:08:24] | justinh: | (before we moved to ECOS) |
| [08:08:46] | justinh: | heheh.. they ARE using at least bits of the linux kernel. figures |
| [08:10:30] | esperegu (esperegu!~quassel@145.116.15.244) has joined #mythtv-users | |
| [08:10:42] | justinh: | definitely looks like they got served with a GPL violation notice to me |
| [08:13:02] | ** Peitolm wishes it were legal to use a DVB-C card in the UK ** | |
| [08:13:13] | justinh: | it's not illegal |
| [08:13:25] | justinh: | it'd be a civil matter between you & the cable co |
| [08:13:43] | Peitolm: | um, no, it would fall under obtaining service by deception wouldn't it |
| [08:14:40] | Peitolm: | besides, i knew if i'd have said 'if it were possible to use a DVB-C card in the UK' someone would have jumped on it ans said "it's possible, just don't attach it to the Virginmedia cable network' |
| [08:17:13] | dan4dm (dan4dm!~dan@danstowell.demon.co.uk) has joined #mythtv-users | |
| [08:24:05] | jovox_ (jovox_!~jovox_@c-b21cf350-74736162.cust.telenor.se) has quit (Read error: Connection reset by peer) | |
| [08:29:08] | hpeter (hpeter!~hpeter@250-203.5-85.cust.bluewin.ch) has joined #mythtv-users | |
| [08:29:44] | justinh: | Peitolm: it wouldn't be deception. all it'd be would be violation of VM's T&Cs |
| [08:30:15] | justinh: | and even then they don't specifically state that you're not allowed to connect 3rd party equipment anymore. you can look yourself |
| [08:30:30] | justinh: | NTL & C&W always said that but the VM T&Cs don't even mention it |
| [08:31:09] | justinh: | what they do *not* however do is provide a means of decrypting pay tv channels – so any attempt on your part to decode them *would* be illegal |
| [08:32:51] | justinh: | so on a technicality you might be allowed under UK law to connect a DVB-C card all you'll get is whatever they send out unencrippled |
| [08:33:26] | justinh: | if you went further.. well *then* it's a very dodgy area since VM don't provide CAMs to end users |
| [08:34:27] | justinh: | they're apparently going the way of IPTV eventually – maybe then we'll be able to access & do as we like with whatever we pay them for – within reason.. but I somehow doubt it. I'm not one of those wet-behind-the-ears 'believers' in IPTV |
| [08:35:02] | flabberkenny (flabberkenny!~flabberke@095-097-072-154.static.chello.nl) has joined #mythtv-users | |
| [08:35:06] | justinh: | I personally see IPTV as a great *disabler* – and I've always been cynical about it |
| [08:35:18] | justinh: | well that and everything else :P |
| [08:44:28] | jk-- (jk--!~jk@ppp121-45-254-43.lns20.per2.internode.on.net) has joined #mythtv-users | |
| [08:45:47] | mobile (mobile!~mobile@c-24-23-108-198.hsd1.oh.comcast.net) has joined #mythtv-users | |
| [08:46:50] | jk- (jk-!~jk@ppp121-45-251-169.lns20.per2.internode.on.net) has quit (Ping timeout: 276 seconds) | |
| [08:54:32] | hashbang (hashbang!~hashbang@cse-ajb.cse.bris.ac.uk) has joined #mythtv-users | |
| [09:00:20] | pak0 (pak0!~Paco@197.127.221.87.dynamic.jazztel.es) has joined #mythtv-users | |
| [09:01:21] | mobile (mobile!~mobile@c-24-23-108-198.hsd1.oh.comcast.net) has quit (Remote host closed the connection) | |
| [09:07:29] | EvilGuru (EvilGuru!~freddie@warzone2100/developer/EvilGuru) has left #mythtv-users () | |
| [09:07:53] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has quit (Remote host closed the connection) | |
| [09:10:48] | rraasch (rraasch!~ryan@80.72.151.98) has joined #mythtv-users | |
| [09:12:42] | And4713 (And4713!~And4713@c-98-201-146-20.hsd1.tx.comcast.net) has joined #mythtv-users | |
| [09:16:08] | awoodland (awoodland!~woodalan@quintus.guest.lislan.org.uk) has quit (Ping timeout: 250 seconds) | |
| [09:16:16] | justinh: | @foolishuser said "Is the code for GoogleTV open source?? I would like to integrate it with my MythTV box." LOL |
| [09:16:41] | chainsawbike (chainsawbike!~chainsawb@chainsawbike-1-pt.tunnel.tserv25.sin1.ipv6.he.net) has quit (Ping timeout: 276 seconds) | |
| [09:16:53] | awoodland (awoodland!~woodalan@2001:8b0:ffc7:1:e60:76ff:fe0a:c161) has joined #mythtv-users | |
| [09:18:27] | chainsawbike (chainsawbike!~chainsawb@chainsawbike-1-pt.tunnel.tserv25.sin1.ipv6.he.net) has joined #mythtv-users | |
| [09:24:04] | johd (johd!~johd@90.146.55.47) has joined #mythtv-users | |
| [09:28:48] | waza-ari (waza-ari!~waza-ari@pD95FEC20.dip.t-dialin.net) has joined #mythtv-users | |
| [09:30:55] | waza-ari: | Hey all, i have a question: How can i seperate my movies and series in MythVideo? I dont want them listed together, it would be perfect if i could just "switch" between Series and Movie mode... What is your solution to orgranise them? Thanks in advance :) |
| [09:31:14] | justinh: | you can't just do that |
| [09:31:41] | justinh: | you could try to organise them by category though – but then there's no simple one-key method to switch between categories |
| [09:34:07] | drindt (drindt!~drindt@89.204.137.65) has joined #mythtv-users | |
| [09:34:13] | waza-ari: | hm... okay, then i will go on only watching the movies via myth.. |
| [09:35:10] | justinh: | and using XBMC presumably :-\ |
| [09:35:57] | waza-ari: | Since im also watching tv, i would like to stay with myth... |
| [09:36:14] | waza-ari: | but thats a feature which would be gread in future :) |
| [09:36:19] | justinh: | gread? |
| [09:36:24] | waza-ari: | great |
| [09:36:26] | waza-ari: | sorry :) |
| [09:36:33] | justinh: | just put your movies in one folder & your TV series in another folder |
| [09:36:46] | justinh: | then you don't need to use categories – if you use the correct view in mythvideo |
| [09:38:17] | waza-ari: | i'm currently using this "flat view" in order to avoid any folder structure... Then i would need to put all the movies directly in this folder – currently the movies are sorted in their own directory... |
| [09:38:54] | justinh: | then you won't be able to separate movies & tv |
| [09:39:41] | waza-ari: | thats what i guessed... okay, thanks anyway ;) |
| [09:52:46] | justinh: | bye bye Spooks! |
| [09:53:11] | esperegu (esperegu!~quassel@145.116.15.244) has quit (Read error: No route to host) | |
| [09:54:18] | BLZbubba (BLZbubba!~mark@tpsit.com) has quit (Ping timeout: 240 seconds) | |
| [09:58:28] | waza-ari (waza-ari!~waza-ari@pD95FEC20.dip.t-dialin.net) has quit (Read error: Connection reset by peer) | |
| [10:00:36] | vezza (vezza!~andrea@host80-45-dynamic.17-87-r.retail.telecomitalia.it) has quit (Quit: Ex-Chat) | |
| [10:07:29] | awoodland (awoodland!~woodalan@2001:8b0:ffc7:1:e60:76ff:fe0a:c161) has quit (Ping timeout: 252 seconds) | |
| [10:08:02] | joat (joat!~joat@ip70-174-79-200.hr.hr.cox.net) has joined #mythtv-users | |
| [10:11:47] | awoodland (awoodland!~woodalan@quintus.guest.lislan.org.uk) has joined #mythtv-users | |
| [10:16:00] | joat (joat!~joat@ip70-174-79-200.hr.hr.cox.net) has quit (Quit: Leaving) | |
| [10:28:48] | pak0 (pak0!~Paco@197.127.221.87.dynamic.jazztel.es) has quit (Quit: This computer has gone to sleep) | |
| [10:46:15] | Dave123-road (Dave123-road!~dave@cpe-74-74-222-96.rochester.res.rr.com) has quit (Read error: Connection reset by peer) | |
| [10:54:20] | pyther (pyther!~pyther@adsl-99-85-38-4.dsl.bcvloh.sbcglobal.net) has joined #mythtv-users | |
| [10:54:20] | pyther (pyther!~pyther@adsl-99-85-38-4.dsl.bcvloh.sbcglobal.net) has quit (Changing host) | |
| [10:54:20] | pyther (pyther!~pyther@unaffiliated/pyther) has joined #mythtv-users | |
| [10:54:36] | superdump (superdump!~rob@unaffiliated/superdump) has quit (Quit: WeeChat 0.3.2) | |
| [10:56:43] | lyricnz (lyricnz!~simonrobe@ppp118-209-224-142.lns20.mel6.internode.on.net) has joined #mythtv-users | |
| [11:00:07] | jya (jya!~avenardj@gw2.hydrix.com) has quit (Quit: jya) | |
| [11:02:28] | Dave123 (Dave123!~dave@cpe-74-74-222-96.rochester.res.rr.com) has quit (Quit: Leaving) | |
| [11:05:53] | jayage (jayage!d596017a@gateway/web/freenode/ip.213.150.1.122) has joined #mythtv-users | |
| [11:06:36] | joat (joat!~joat@ip70-174-79-200.hr.hr.cox.net) has joined #mythtv-users | |
| [11:13:47] | SteveGoodey (SteveGoodey!~steve@host86-150-109-41.range86-150.btcentralplus.com) has joined #mythtv-users | |
| [11:18:43] | pyther (pyther!~pyther@unaffiliated/pyther) has quit (Ping timeout: 240 seconds) | |
| [11:32:07] | superdump (superdump!~rob@unaffiliated/superdump) has joined #mythtv-users | |
| [11:38:34] | SteveGoodey (SteveGoodey!~steve@host86-150-109-41.range86-150.btcentralplus.com) has quit (Remote host closed the connection) | |
| [11:40:49] | jayage (jayage!d596017a@gateway/web/freenode/ip.213.150.1.122) has quit (Quit: Page closed) | |
| [11:41:16] | justinh: | ooo the new humax hd dvb-t2 dvr can skip by a definable amount |
| [11:43:38] | bbee2 (bbee2!~bbee@2001:888:155c::13) has quit (Remote host closed the connection) | |
| [11:44:14] | bbee (bbee!~bbee@2001:888:155c::13) has joined #mythtv-users | |
| [11:44:14] | bbee (bbee!~bbee@2001:888:155c::13) has quit (Changing host) | |
| [11:44:14] | bbee (bbee!~bbee@unaffiliated/bbee) has joined #mythtv-users | |
| [11:44:59] | AriX (AriX!~Ari@c-76-98-240-212.hsd1.pa.comcast.net) has quit (Quit: Leaving...) | |
| [11:46:57] | AriX (AriX!~Ari@c-76-98-240-212.hsd1.pa.comcast.net) has joined #mythtv-users | |
| [11:47:45] | AriX (AriX!~Ari@c-76-98-240-212.hsd1.pa.comcast.net) has quit (Client Quit) | |
| [11:49:15] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has joined #mythtv-users | |
| [11:50:54] | damo22 (damo22!~damo22@c114-76-75-108.thoms3.vic.optusnet.com.au) has joined #mythtv-users | |
| [11:51:22] | damo22: | has anyone had experience building mythtv with VDPAU support? |
| [11:51:37] | justinh: | yup |
| [11:51:42] | damo22: | im building a mythtv box out of a uATX mobo with geforce 8200 onboard and HDMI out... |
| [11:52:05] | justinh: | get all the dependencies, the right driver version & you should be good to go |
| [11:52:15] | damo22: | sweet |
| [11:53:22] | damo22: | i like ubuntu, should i go with mythbuntu or just plain ubuntu and build mythtv from source? |
| [11:54:13] | justinh: | nobody can really tell you that |
| [11:54:44] | jya (jya!~avenardj@60-242-40-141.static.tpgi.com.au) has joined #mythtv-users | |
| [11:54:52] | justinh: | there's only one way to know exactly what you're getting IMHO – and that's to build myth from source – I do a checkout of -fixes from svn |
| [11:55:31] | damo22: | yeah i plan on getting the latest source |
| [11:55:48] | joat (joat!~joat@ip70-174-79-200.hr.hr.cox.net) has quit (Quit: Leaving) | |
| [11:56:30] | damo22: | but i think i'll install mythbuntu and hack it to the latest svn |
| [11:56:42] | justinh: | probably not a good idea right now |
| [11:56:56] | damo22: | no? |
| [11:57:44] | justinh: | if you use svn trunk it's very wise to keep up to date with the -commits & -dev mailing lists – and word on the street. If you did that you'd know there are still some serious issues in trunk which need to be resolved |
| [11:58:11] | justinh: | but if you're just planning to run -fixes on mythbuntu you can just use their -fixes repo |
| [11:59:18] | damo22: | i see |
| [12:00:20] | damo22: | ever got PC to wake and sleep using the LIRC remote? |
| [12:00:41] | justinh: | nope. I'm not lazy enough :-) |
| [12:00:54] | JJ1 (JJ1!~jjensen@jeffjensen.dsl.visi.com) has left #mythtv-users () | |
| [12:00:54] | justinh: | my frontend boots from cold in < 25 secs anyway |
| [12:01:45] | damo22: | yeah but it is possible right? |
| [12:02:05] | justinh: | depends |
| [12:02:28] | justinh: | if your IR receiver is USB & the motherboard supports waking from a USB device then sure |
| [12:02:35] | damo22: | need to enable PME wakeup or something on the right PCI IRQ? |
| [12:02:48] | justinh: | why not try searching the wiki? |
| [12:03:13] | damo22: | i like discussing with real people |
| [12:03:33] | damo22: | :) |
| [12:04:26] | xris (xris!~xris@xris.forevermore.net) has quit (Ping timeout: 276 seconds) | |
| [12:04:30] | jamesd2 (jamesd2!~jamesd@76.229.211.23) has joined #mythtv-users | |
| [12:05:34] | damo22: | besides you just saved me an hour of reading |
| [12:05:56] | damo22: | :P |
| [12:05:56] | justinh (justinh!~justin@cpc1-salf4-0-0-cust69.10-2.cable.virginmedia.com) has left #mythtv-users () | |
| [12:06:38] | damo22 (damo22!~damo22@c114-76-75-108.thoms3.vic.optusnet.com.au) has quit (Quit: Leaving) | |
| [12:07:16] | justinh (justinh!~justin@cpc1-salf4-0-0-cust69.10-2.cable.virginmedia.com) has joined #mythtv-users | |
| [12:12:40] | jamesd_laptop (jamesd_laptop!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has joined #mythtv-users | |
| [12:13:56] | Dave123 (Dave123!~dave@cpe-74-74-222-96.rochester.res.rr.com) has joined #mythtv-users | |
| [12:15:02] | lyricnz (lyricnz!~simonrobe@ppp118-209-224-142.lns20.mel6.internode.on.net) has quit (Quit: lyricnz) | |
| [12:15:20] | jamesd2 (jamesd2!~jamesd@76.229.211.23) has quit (Ping timeout: 240 seconds) | |
| [12:15:28] | inordkuo (inordkuo!~inorkuo@adsl-18-178-55.int.bellsouth.net) has quit (Quit: Leaving.) | |
| [12:15:52] | adante_ (adante_!~adante@59.167.212.65) has joined #mythtv-users | |
| [12:16:48] | adante (adante!~adante@59.167.212.65) has quit (Ping timeout: 240 seconds) | |
| [12:16:52] | adante_ is now known as adante | |
| [12:26:57] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has joined #mythtv-users | |
| [12:28:42] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has quit (Remote host closed the connection) | |
| [12:30:27] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has joined #mythtv-users | |
| [12:33:53] | inordkuo (inordkuo!~inorkuo@nsc64.16.142-198.newsouth.net) has joined #mythtv-users | |
| [12:39:06] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has quit (Read error: Operation timed out) | |
| [12:40:53] | rraasch (rraasch!~ryan@80.72.151.98) has quit (Quit: Leaving) | |
| [12:54:42] | map7_ (map7_!~map7@120.156.34.149) has joined #mythtv-users | |
| [12:55:18] | devinheitmueller (devinheitmueller!~devin@c-71-205-242-159.hsd1.mi.comcast.net) has joined #mythtv-users | |
| [13:01:16] | RockHound (RockHound!~quassel@d008085.adsl.hansenet.de) has quit (Ping timeout: 265 seconds) | |
| [13:07:13] | devinheitmueller (devinheitmueller!~devin@c-71-205-242-159.hsd1.mi.comcast.net) has quit (Ping timeout: 252 seconds) | |
| [13:09:43] | devinheitmueller (devinheitmueller!~devin@c-71-205-242-159.hsd1.mi.comcast.net) has joined #mythtv-users | |
| [13:11:03] | dan4dm_ (dan4dm_!~dan@138.37.34.21) has joined #mythtv-users | |
| [13:11:13] | dan4dm_ (dan4dm_!~dan@138.37.34.21) has left #mythtv-users () | |
| [13:12:20] | map7_ (map7_!~map7@120.156.34.149) has quit (Ping timeout: 240 seconds) | |
| [13:15:02] | dan4dm (dan4dm!~dan@danstowell.demon.co.uk) has quit (Ping timeout: 264 seconds) | |
| [13:16:21] | BLZbubba (BLZbubba!~mark@tpsit.com) has joined #mythtv-users | |
| [13:16:44] | draioch (draioch!~draioch@109.76.31.53) has quit (Quit: draioch) | |
| [13:17:18] | draioch (draioch!~draioch@109.76.31.53) has joined #mythtv-users | |
| [13:23:06] | jamesd_laptop (jamesd_laptop!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has quit (Read error: Connection reset by peer) | |
| [13:23:39] | jamesd_laptop (jamesd_laptop!~jamesd@76.229.211.23) has joined #mythtv-users | |
| [13:24:00] | jamesd_laptop (jamesd_laptop!~jamesd@76.229.211.23) has quit (Read error: Connection reset by peer) | |
| [13:24:34] | jamesd_laptop (jamesd_laptop!~jamesd@76.229.211.23) has joined #mythtv-users | |
| [13:29:10] | johd (johd!~johd@90.146.55.47) has quit (Remote host closed the connection) | |
| [13:29:59] | xcrracer (xcrracer!~xcrracer@216.120.170.5) has joined #mythtv-users | |
| [13:43:03] | xcrracer (xcrracer!~xcrracer@216.120.170.5) has quit (Quit: xcrracer) | |
| [13:48:35] | justinh: | "MAYDAY! Slave has jumped ship and left the following info..." – not what I want to be seeing in debug output from a unit |
| [13:59:38] | xris (xris!~xris@xris.forevermore.net) has joined #mythtv-users | |
| [14:05:05] | Gibby (Gibby!~gibby@204.118.10.244) has quit (Ping timeout: 252 seconds) | |
| [14:05:06] | Gibby13 (Gibby13!~gibby@204.118.10.244) has joined #mythtv-users | |
| [14:07:47] | at0m (at0m!~at0m@94-225-90-23.access.telenet.be) has joined #mythtv-users | |
| [14:08:29] | stoth_ (stoth_!~stoth@ool-4572125f.dyn.optonline.net) has joined #mythtv-users | |
| [14:12:58] | xcrracer (xcrracer!~xcrracer@216.120.170.5) has joined #mythtv-users | |
| [14:34:30] | AndyCap: | justinh: mutiny? :P |
| [14:41:15] | stoth_ (stoth_!~stoth@ool-4572125f.dyn.optonline.net) has quit (Quit: stoth_) | |
| [14:49:50] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has joined #mythtv-users | |
| [14:55:25] | streeter (streeter!~streeter@nat/redhat/x-tlkgnvjvacocujks) has joined #mythtv-users | |
| [15:07:39] | superdump (superdump!~rob@unaffiliated/superdump) has quit (Quit: WeeChat 0.3.2) | |
| [15:08:37] | GadgetWisdomGuru (GadgetWisdomGuru!~gwg@66.114.64.53) has quit (Quit: Leaving.) | |
| [15:12:35] | KraMer (KraMer!~mark@adsl-70-240-190-175.dsl.hstntx.swbell.net) has joined #mythtv-users | |
| [15:14:05] | abqjp (abqjp!~abqjp@97-119-165-177.albq.qwest.net) has joined #mythtv-users | |
| [15:23:48] | JJ2 (JJ2!~jjensen@jeffjensen.dsl.visi.com) has joined #mythtv-users | |
| [15:24:43] | natanojl (natanojl!~jonatan@c83-252-237-63.bredband.comhem.se) has joined #mythtv-users | |
| [15:31:09] | JJ3 (JJ3!~jjensen@mail.intertech.com) has joined #mythtv-users | |
| [15:31:35] | SteveGoodey (SteveGoodey!~steve@host86-150-109-41.range86-150.btcentralplus.com) has joined #mythtv-users | |
| [15:32:04] | JJ2 (JJ2!~jjensen@jeffjensen.dsl.visi.com) has quit (Ping timeout: 264 seconds) | |
| [15:34:40] | jamesd_laptop (jamesd_laptop!~jamesd@76.229.211.23) has quit (Read error: Connection reset by peer) | |
| [15:35:13] | jamesd_laptop (jamesd_laptop!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has joined #mythtv-users | |
| [15:36:07] | jamesd_laptop (jamesd_laptop!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has quit (Read error: Connection reset by peer) | |
| [15:36:38] | jamesd_laptop (jamesd_laptop!~jamesd@76.229.211.23) has joined #mythtv-users | |
| [15:38:51] | stoffel (stoffel!~quassel@p57B4ABFD.dip.t-dialin.net) has joined #mythtv-users | |
| [15:38:51] | Mode for #mythtv-users by ChanServ!ChanServ@services. : +v stoffel | |
| [15:48:49] | Wicked (Wicked!~zero@unaffiliated/blazed) has quit (Read error: Connection reset by peer) | |
| [15:50:16] | Prost (Prost!prost@who.knows.what.possessed.us) has quit (Quit: ZNC - http://znc.sourceforge.net) | |
| [15:50:29] | christ` (christ`!~Billybob@CPE00e04b0b7799-CM00111a59bdac.cpe.net.cable.rogers.com) has quit (Ping timeout: 255 seconds) | |
| [15:52:09] | hpeter (hpeter!~hpeter@250-203.5-85.cust.bluewin.ch) has quit (Quit: hpeter) | |
| [15:53:31] | Wicked (Wicked!~zero@unaffiliated/blazed) has joined #mythtv-users | |
| [15:59:16] | Easy_Rider9999 (Easy_Rider9999!~Miranda@p5B226984.dip.t-dialin.net) has joined #mythtv-users | |
| [16:02:16] | hashbang (hashbang!~hashbang@cse-ajb.cse.bris.ac.uk) has quit (Remote host closed the connection) | |
| [16:05:24] | flabberkenny (flabberkenny!~flabberke@095-097-072-154.static.chello.nl) has quit (Quit: flabberkenny) | |
| [16:08:03] | christ` (christ`!~Billybob@CPE00e04b0b7799-CM00111a59bdac.cpe.net.cable.rogers.com) has joined #mythtv-users | |
| [16:16:37] | wagnerrp: | iamlindoro: where are the settings for grabber selection now? cant find them in the frontend |
| [16:16:47] | iamlindoro: | They don't exist |
| [16:16:57] | wagnerrp: | that... would be why, thanks |
| [16:17:05] | iamlindoro: | there's only one of each type of script, so hadn't rewritten those pickers |
| [16:17:32] | wagnerrp: | about to add the $PREFIX handling so i can find them if the database settings dont exist |
| [16:17:43] | wagnerrp: | i figure that should go in for 0.24 |
| [16:23:53] | wagnerrp: | i could have sworn i committed some code that would replace the bang path in installed scripts with the install executable |
| [16:23:57] | wagnerrp: | i seem to be imagining things |
| [16:26:30] | mobile_ (mobile_!~mobile@c-24-23-108-198.hsd1.oh.comcast.net) has joined #mythtv-users | |
| [16:26:44] | wagnerrp: | worse... its actually doing it, but i cant figure out why or how |
| [16:29:38] | JJ1 (JJ1!~jjensen@jeffjensen.dsl.visi.com) has joined #mythtv-users | |
| [16:29:48] | Hoxzer: | ttt |
| [16:30:27] | wagnerrp: | ah, seems the setup tools are doing that automatically |
| [16:31:42] | cromag: | there is somehting about i can via web, watch tv via mythtv right ? |
| [16:32:01] | wagnerrp: | you can stream recordings through mythweb |
| [16:32:13] | cromag: | only recordings ? |
| [16:32:15] | wagnerrp: | you can have mythweb do a live-transcode of recordings to flash video |
| [16:32:18] | MilkBoy (MilkBoy!~milkboy@2a00:16a0::a800:c1ff:fe40:f4b2) has quit (Read error: Operation timed out) | |
| [16:32:21] | wagnerrp: | but you cannot do anything with livetv |
| [16:32:47] | cromag: | ok. |
| [16:33:38] | JJ3 (JJ3!~jjensen@mail.intertech.com) has quit (Ping timeout: 264 seconds) | |
| [16:34:09] | drindt (drindt!~drindt@89.204.137.65) has quit (Quit: Mary had a little Segmentation fault) | |
| [16:34:41] | RDV_Linux (RDV_Linux!~doug@CPE001195554bb4-CM00252eac6f40.cpe.net.cable.rogers.com) has quit (Remote host closed the connection) | |
| [16:35:42] | sebrock (sebrock!~sebrock@hd5b90669.selukra.dyn.perspektivbredband.net) has joined #mythtv-users | |
| [16:42:52] | jamesd_laptop (jamesd_laptop!~jamesd@76.229.211.23) has quit (Quit: Leaving) | |
| [16:43:11] | jamesd2 (jamesd2!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has joined #mythtv-users | |
| [16:44:35] | tgm4883 (tgm4883!~tgm4883@ubuntu/member/tgm4883) has quit (Quit: Coyote finally caught me) | |
| [16:45:41] | mobile_ (mobile_!~mobile@c-24-23-108-198.hsd1.oh.comcast.net) has quit (Remote host closed the connection) | |
| [16:46:12] | tgm4883 (tgm4883!~tgm4883@204.8.45.13) has joined #mythtv-users | |
| [16:46:13] | tgm4883 (tgm4883!~tgm4883@204.8.45.13) has quit (Changing host) | |
| [16:46:13] | tgm4883 (tgm4883!~tgm4883@ubuntu/member/tgm4883) has joined #mythtv-users | |
| [16:46:19] | Saviq_afk is now known as Saviq | |
| [16:46:21] | jams (jams!~jams@cpe-184-58-217-97.wi.res.rr.com) has quit (Ping timeout: 260 seconds) | |
| [16:46:27] | jams (jams!~jams@cpe-184-58-217-97.wi.res.rr.com) has joined #mythtv-users | |
| [16:46:27] | Mode for #mythtv-users by ChanServ!ChanServ@services. : +v jams | |
| [16:47:48] | MilkBoy (MilkBoy!~milkboy@2a00:16a0::a800:c1ff:fe40:f4b2) has joined #mythtv-users | |
| [16:48:09] | Goga777 (Goga777!~Goga777@shpd-92-101-147-234.vologda.ru) has joined #mythtv-users | |
| [16:53:58] | sebrock (sebrock!~sebrock@hd5b90669.selukra.dyn.perspektivbredband.net) has quit (Quit: US: http://bit.ly/c8i2c4 || SE: http://bit.ly/bUNw9I) | |
| [16:54:24] | kormoc is now known as kormoc_afk | |
| [16:57:37] | Nede (Nede!~milanese@host196-207-dynamic.24-79-r.retail.telecomitalia.it) has joined #mythtv-users | |
| [16:57:54] | Nede: | hi |
| [16:57:59] | Nede: | one question |
| [16:58:13] | wagnerrp: | iamlindoro: what did you say the variable names would be when you did put them back in? |
| [16:58:17] | Nede: | mythv 64 or 32 bit? |
| [16:58:27] | wagnerrp: | Nede: do you have a 64-bit processor? |
| [16:58:37] | iamlindoro: | wagnerrp: They're actually in and respected |
| [16:58:42] | iamlindoro: | MovieGrabber and TelevisionGrabber |
| [16:58:46] | iamlindoro: | there's just no UI to pick scripts |
| [16:58:57] | Nede: | <wagnerrp> hi!!!! your fine? Yes, 64 bit |
| [16:59:02] | wagnerrp: | iamlindoro: right, theres no way to define them but manually |
| [16:59:07] | wagnerrp: | im fine? |
| [16:59:07] | Nede: | for distro mythbuntu.... |
| [16:59:09] | iamlindoro: | right |
| [16:59:28] | Nede: | <wagnerrp>ehm... i'm italian..... |
| [16:59:45] | wagnerrp: | the amd64 architecture has been around for over 7 years |
| [16:59:46] | iamlindoro: | nobody's perfect |
| [17:00:16] | wagnerrp: | the only issue remaining with 64-bit systems is a worthless adobe putting out buggy 64-bit versions of their flash player |
| [17:00:23] | wagnerrp: | and thats only ever going to be used in mythnetvision |
| [17:00:39] | wagnerrp: | and there are ways around that issue |
| [17:01:26] | tgm4883: | I'd use 64-bit |
| [17:02:00] | Nede: | then I would have problems netvision right? |
| [17:05:57] | iamlindoro: | not if you pick the right version of Qt + the right version of Flash |
| [17:06:38] | Nede: | mmm ah ok! |
| [17:07:56] | Nede: | but the Mythbuntu distro already has 64-bit versions right? |
| [17:08:47] | iamlindoro: | yes, they do |
| [17:09:01] | Nede: | ok!!!! perfect |
| [17:10:14] | Nede: | I assembled a mini-itx motherboard with this and I'm studying to do what is best! ASUS Fanless AT5IONT-I Dual Core 1.8GHz Atom ION2 Board with USB 3.0 |
| [17:10:14] | draioch: | hi can anyone help with some recommendations on linux compatable hardware for mythtv |
| [17:10:39] | wagnerrp: | draioch: buy x86 |
| [17:12:43] | draioch: | wagnerrp: that refers to the motherboard architecture? |
| [17:12:52] | wagnerrp: | motherboard, processor, etc... |
| [17:12:58] | draioch: | ok thanks |
| [17:13:03] | wagnerrp: | or were you looking for tuner card suggestions? |
| [17:13:17] | wagnerrp: | !url tuners |
| [17:13:18] | MythLogBot: | tuners: http://www.linuxtv.org/wiki/index.php/Hardwar . . . _Information |
| [17:13:24] | draioch: | any suggestions would be helpful as im starting from scratch |
| [17:13:35] | draioch: | thanks |
| [17:14:35] | draioch: | do most people built there own pc had a look on the site myth.org for pre config but not that many to choose from |
| [17:15:04] | wagnerrp: | myth.org? looks nearly vacant to me |
| [17:16:49] | draioch: | sorry http://www.mythtv.org/ |
| [17:17:21] | draioch: | is http://www.linuxtv.org better |
| [17:17:26] | wagnerrp: | mythtv.org does not produce or sell commercial units, however the wiki lists of handful of 3rd part retailers selling pre-configured mythtv systems |
| [17:17:43] | wagnerrp: | mythtv.org is our site, dedicated to this DVR software |
| [17:18:07] | draioch: | yea seen that thanks not many too choose from that why im wondering about building a HTPC |
| [17:18:08] | wagnerrp: | linuxtv.org is the site for the linuxtv project, dedicated towards the development of linux kernel drivers for tuner hardware |
| [17:18:19] | draioch: | ok thanks for that |
| [17:19:23] | draioch: | although http://www.mythtv.org/wiki/Green_PC_BE20 looks good |
| [17:19:52] | draioch: | as a pre config and the manufacturer confirmed today that its fullt linux compatable |
| [17:20:09] | draioch: | just wondering should i get that or build me own |
| [17:20:25] | wagnerrp: | decent enough, but limited expansion and disk space, and nvidia graphics are recommended |
| [17:21:11] | wagnerrp: | besides, you can get a 40W machine running without much effort |
| [17:21:36] | draioch: | wagnerrp: ok thanks what would u recommend and what is 40W machine |
| [17:21:55] | wagnerrp: | that pc says it consumes ~40W on average |
| [17:22:00] | wagnerrp: | watts |
| [17:22:03] | wagnerrp: | power consumption |
| [17:22:04] | draioch: | ok thanks |
| [17:22:29] | wagnerrp: | we cant recommend hardware unless you tell us your intents |
| [17:22:38] | draioch: | i have access to dell GX280 GX270 from work for free maybe i should just use one of them |
| [17:22:41] | wagnerrp: | what do you wish to do with mythtv |
| [17:23:10] | draioch: | more or less as a multimedia player with LIRC |
| [17:23:21] | draioch: | not so much live tv |
| [17:23:41] | wagnerrp: | if you dont intend to record tv, you dont want to use mythtv |
| [17:24:23] | draioch: | can u use it as a SKY+ alternative? |
| [17:24:39] | wagnerrp: | sky+ is encrypted, and they dont support CAMs |
| [17:24:41] | xcrracer (xcrracer!~xcrracer@216.120.170.5) has quit (Read error: Connection reset by peer) | |
| [17:24:52] | wagnerrp: | so you will need to use a Sky box, and an analog capture device |
| [17:24:57] | deegan____ (deegan____!~deegan@88.83.55.163) has joined #mythtv-users | |
| [17:25:01] | draioch: | yea thats wha i mean |
| [17:25:16] | draioch: | one of those haupage ones maybe? |
| [17:25:55] | draioch: | or wha best linux/mythtv compatable analog capure device |
| [17:26:06] | wagnerrp: | a PVR-150 or PVR-500 for standard definition, or an HDPVR for high definition |
| [17:26:23] | draioch: | yea seen them was thinking about the PVR thanks |
| [17:26:26] | Beirdo: | or HVR-2250 for standard def |
| [17:26:41] | Beirdo: | with the bleeding edge drivers :) |
| [17:26:42] | wagnerrp: | very recently, experimental drivers |
| [17:26:43] | draioch: | is that haupage as well HVR? |
| [17:26:49] | Beirdo: | yes |
| [17:26:59] | draioch: | beirdo: thanks |
| [17:27:04] | wagnerrp: | hauppauge is the only brand i would recommend for analog |
| [17:27:07] | Beirdo: | the PVR-150, 250, 350, 500 are definitely more proven |
| [17:27:15] | draioch: | ok thanks |
| [17:27:16] | wagnerrp: | and currently only those cards that support hardware encoders |
| [17:27:20] | wagnerrp: | not all of them do |
| [17:27:37] | draioch: | and all linux compatable? |
| [17:27:49] | wagnerrp: | no |
| [17:28:00] | draioch: | sorry i mean equally linux compatable |
| [17:28:12] | draioch: | or which is best supported by linux devs |
| [17:28:15] | wagnerrp: | see that linuxtv site, they develop the drivers and have the last word on what is supported |
| [17:28:24] | draioch: | ok thanks |
| [17:28:44] | deegan___ (deegan___!~deegan@88.83.55.139) has quit (Ping timeout: 276 seconds) | |
| [17:29:46] | tgm4883 (tgm4883!~tgm4883@ubuntu/member/tgm4883) has quit (Quit: Coyote finally caught me) | |
| [17:29:48] | draioch: | so haupage for analog capture and nvidia for video out |
| [17:29:54] | tgm4883 (tgm4883!~tgm4883@204.8.45.13) has joined #mythtv-users | |
| [17:29:54] | tgm4883 (tgm4883!~tgm4883@ubuntu/member/tgm4883) has joined #mythtv-users | |
| [17:29:54] | tgm4883 (tgm4883!~tgm4883@204.8.45.13) has quit (Changing host) | |
| [17:30:12] | wagnerrp: | only their supported devices, with hardware encoders |
| [17:30:26] | draioch: | ok thanks |
| [17:30:39] | tgm4883 (tgm4883!~tgm4883@ubuntu/member/tgm4883) has quit (Client Quit) | |
| [17:30:47] | tgm4883 (tgm4883!~tgm4883@204.8.45.13) has joined #mythtv-users | |
| [17:30:47] | tgm4883 (tgm4883!~tgm4883@204.8.45.13) has quit (Changing host) | |
| [17:30:47] | tgm4883 (tgm4883!~tgm4883@ubuntu/member/tgm4883) has joined #mythtv-users | |
| [17:34:58] | Nede: | i go! Good night! Thank!!!!! |
| [17:35:43] | Nede (Nede!~milanese@host196-207-dynamic.24-79-r.retail.telecomitalia.it) has quit (Quit: Sto andando via) | |
| [17:39:08] | deegan____ (deegan____!~deegan@88.83.55.163) has quit (Ping timeout: 276 seconds) | |
| [17:39:24] | deegan____ (deegan____!~deegan@88.83.55.139) has joined #mythtv-users | |
| [17:39:32] | cdpuk (cdpuk!~chris@91.84.144.76) has joined #mythtv-users | |
| [17:39:55] | Easy_Rider9999 (Easy_Rider9999!~Miranda@p5B226984.dip.t-dialin.net) has quit (Read error: Connection reset by peer) | |
| [17:44:56] | kormoc_afk is now known as kormoc | |
| [17:48:26] | pak0 (pak0!~Paco@197.127.221.87.dynamic.jazztel.es) has joined #mythtv-users | |
| [17:48:50] | Saviq is now known as Saviq_afk | |
| [17:56:34] | stoffel (stoffel!~quassel@p57B4ABFD.dip.t-dialin.net) has quit (Remote host closed the connection) | |
| [18:06:58] | flabberkenny (flabberkenny!~flabberke@217-19-28-232.dsl.cambrium.nl) has joined #mythtv-users | |
| [18:07:39] | cesman (cesman!~cecil@pdpc/supporter/professional/cesman) has quit (Remote host closed the connection) | |
| [18:12:04] | Saviq_afk is now known as Saviq | |
| [18:12:36] | Saviq (Saviq!~Saviq@sawicz.net) has left #mythtv-users () | |
| [18:14:21] | GlemSom (GlemSom!~glemsom@0x5da34bca.cpe.ge-1-1-0-1105.sdnqu1.customer.tele.dk) has joined #mythtv-users | |
| [18:27:26] | skd5aner: | heh – Jersey Shore RPG – http://www.collegehumor.com/video:1942081 |
| [18:32:39] | wagnerrp: | i dont get today's google |
| [18:34:34] | kormoc: | wagnerrp, donno know about John Lennon? |
| [18:34:47] | wagnerrp: | no, i only saw the snapshot that is visible on their search page |
| [18:34:56] | wagnerrp: | not the video available on their front page |
| [18:34:58] | iamlindoro: | That's a picture his son drew for him |
| [18:35:01] | kormoc: | ahh |
| [18:35:08] | iamlindoro: | semi-famous image of him |
| [18:36:32] | wagnerrp: | i just mean none of those letters (besides the image of him) really seemed to have anything to do with him |
| [18:46:52] | lyricnz (lyricnz!~simonrobe@ppp118-209-224-142.lns20.mel6.internode.on.net) has joined #mythtv-users | |
| [18:46:58] | flabberkenny (flabberkenny!~flabberke@217-19-28-232.dsl.cambrium.nl) has quit (Ping timeout: 272 seconds) | |
| [18:48:40] | drindt (drindt!~drindt@89.204.137.65) has joined #mythtv-users | |
| [18:49:18] | sphery: | So, this complaint to the FTC about Google's leaking search terms... How does that have /anything/ to do with Google. All browsers are configured to send Referer header by default because too many brain-dead web devs don't understand that it's useless as a security mechanism, so you can't, for example, buy things at newegg without enabling Referer. |
| [18:49:36] | andreax (andreax!~andreaz@p57B94D5D.dip.t-dialin.net) has joined #mythtv-users | |
| [18:49:58] | sphery: | the only thing remotely related to Google is the fact that Google uses GET instead of POST for their search form, but so does Bing and ... |
| [18:51:42] | wagnerrp: | so sphery, youre saying that if i have storage that only exists on a SBE, i should still define it on my MBE? |
| [18:51:51] | wagnerrp: | i have no intention to NFS mount it over |
| [18:52:07] | totalanni is now known as _totalann | |
| [18:52:15] | sphery: | wagnerrp: IMHO, yes |
| [18:52:26] | _totalann is now known as totalanni | |
| [18:52:37] | sphery: | then there's only one place to maintain SG dir lists |
| [18:52:49] | sphery: | and it always works--regardless of how many new backends you add |
| [18:53:17] | sphery: | however, if you were NFS mounting it, you might not want it defined on the master |
| [18:53:41] | sphery: | or you'd have to choose an appropriate SG disk scheduler |
| [18:56:42] | sphery: | basically, if you define an override of your directory lists on the remote backend, then when you add a new remote backend, you'd likely do the same (possibly with the exact same dir list). When you need to change the directories used on the remote backend, you have to change them on that specific remote backend. When you get rid of that remote backend, you will likely forget to delete the SG overrides for that host, so it can ... |
| [18:56:48] | sphery: | ... cause problems with new hosts falling back to invisible dir lists when the new host has no valid directories defined (or inherits no valid directories from the MBE) |
| [18:57:10] | sphery: | Note, though, that it only works for TV SG's since MythVideo uses SGs differently. |
| [19:04:34] | wagnerrp: | right |
| [19:04:50] | Mode for #mythtv-users by ChanServ!ChanServ@services. : +v xris | |
| [19:18:57] | Goga777 (Goga777!~Goga777@shpd-92-101-147-234.vologda.ru) has quit (Remote host closed the connection) | |
| [19:24:23] | GlemSom: | I've installed mythnetvision mostly for youtube videoes... But, when trying to start a video, I just get a blank screen (white)... I have flash installed and working in firefox, so I'm a bit unsure where to go from here ? |
| [19:24:37] | wagnerrp: | check your frontend logs |
| [19:26:30] | GlemSom: | wagnerrp, no errors when using "media,important,general,playback"... Do I need something else here ? |
| [19:26:50] | wagnerrp: | you see the page, the video just doesnt play? |
| [19:27:21] | iamlindoro: | If you are getting a blank screen, then the flash player is not installed where QTWebKit expects to find it |
| [19:27:49] | SteveGoodey (SteveGoodey!~steve@host86-150-109-41.range86-150.btcentralplus.com) has quit (Ping timeout: 252 seconds) | |
| [19:27:49] | iamlindoro: | Firefox and Qt expect to find their NSPlugins in different locations, IIRC, though I can't recall where Qt expects them to be |
| [19:28:10] | GlemSom: | wagnerrp, Well, I guess I see a page... It's just white only, and it keeps saying "Loading" at the top... |
| [19:28:27] | sphery: | webkit picks up mine from $HOME/.mozilla/plugins |
| [19:28:41] | GlemSom: | Think mine is installed globally... |
| [19:28:42] | sphery: | but it's important that it's the $HOME for the user that runs mythfrontend |
| [19:28:47] | GlemSom: | Does it pick that one up too ? |
| [19:28:52] | sphery: | never tried |
| [19:29:46] | wagnerrp: | ugh... seems open-iscsi is refusing to run without authentication |
| [19:29:50] | sphery: | try just symlinking the global plugins dir at $HOME/.mozilla/plugins |
| [19:29:57] | GlemSom: | Ohh wait a sec... I'm using nswrapper... Now when I think of it.. That might be the issue here |
| [19:30:04] | wagnerrp: | so when i start it up after boot, it tries, and fails, to log into the target |
| [19:30:05] | sphery: | yeah |
| [19:30:12] | wagnerrp: | resulting in loss of my boot disk |
| [19:30:34] | GlemSom: | iirc there was a 64bit beta flash out.. I'll install that, and give it a go |
| [19:30:46] | sphery: | I just don't get the concept of installing Adobe Crash in global plugins. |
| [19:31:32] | sphery: | GlemSom: you need Qt 4.7 for it to work |
| [19:31:46] | sphery: | Flash 10.1 and the 10.2 alpha both have a bug that Adobe refuses to fix |
| [19:31:49] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has joined #mythtv-users | |
| [19:31:51] | sphery: | even though it's a single line of code |
| [19:32:10] | sphery: | Qt 4.7's Qt-Webkit (v2.0) has a workaround |
| [19:32:30] | sphery: | that said, alpha is a good description of 10.2 |
| [19:33:32] | GlemSom: | sphery, Yeah, seems it crashes the frontend :( |
| [19:33:38] | ** wagnerrp really needs a remote power switch ** | |
| [19:34:37] | GlemSom: | And I only have qt 4.6... :/ |
| [19:34:43] | GlemSom: | Guess I'm out of luck then... |
| [19:38:17] | sphery: | Just wait 'til Microsoft buys Adobe. They'll make it all better. |
| [19:38:25] | sphery: | (joke, the NYT is way off on that one) |
| [19:38:34] | hadees (hadees!~hadees@72-48-211-19.dyn.grandenetworks.net) has quit (Quit: hadees) | |
| [19:39:49] | sphery: | GlemSom: FWIW, it is possible to find links to the Flash 10.0 64-bit version. That said, some sites (such as Hulu) will refuse to allow you to use Flash 10.0 "for your protection" (because it's know to have major security problems) |
| [19:40:45] | johnnyj (johnnyj!~chatzilla@cpe-173-172-31-183.tx.res.rr.com) has joined #mythtv-users | |
| [19:41:01] | sphery: | also, the fact that Adobe pulled all 10.0 and 10.1 versions of the GNU/Linux 64-bit Flash plugin should say something about the inherent problems with finding and using the old version--so if you do that, all consequences are on you :) |
| [19:41:44] | johnnyj: | sphery: i couldn't replicate that mythmovie library issue today – maybe I was misreading an older log file |
| [19:42:00] | sphery: | cool |
| [19:42:04] | sphery: | glad it's working now |
| [19:42:11] | wagnerrp: | mythmovie issue? |
| [19:42:19] | johnnyj: | i know you where /dieing/ to see a strace output from me |
| [19:42:27] | sphery: | it was finding an old 0.23-fixes plugin and not working with trunk |
| [19:42:32] | sphery: | heh, yeah |
| [19:42:51] | sphery: | I love reading 10M lines of garbage to find the one filename I'm looking to find |
| [19:43:25] | johnnyj: | so i have something new I'm looking at – AudioOutput Error: Aborting Audio Reconfigure. Invalid audio parameters ch 2 fmt 0 @ 44100Hz |
| [19:43:36] | ** wagnerrp was under the impression mythmovie had no bugs, flaws, or for that matter code of any sort ** | |
| [19:43:50] | iamlindoro: | johnnyj: Are you actually seeing an issue, or just looking at anything that says error? |
| [19:44:00] | iamlindoro: | Since that line alone doesn't necessarily mean anything |
| [19:44:06] | sphery: | johnnyj: jya said that's an ignorable message. I think he said he plans to move it to a different verbose level |
| [19:44:19] | johnnyj: | sphery: thank you much |
| [19:45:04] | johnnyj: | iamlindoro: yes, I have some general glitchy playback and from reading the mailiing list, misconfigued audio has been mentioned |
| [19:45:24] | iamlindoro: | As sphery mentioned seeing it but still having audio means you should ignore it |
| [19:45:48] | iamlindoro: | That message only has meaning the the context of no audio whatsoever |
| [19:46:07] | iamlindoro: | er in the |
| [19:46:21] | johnnyj: | i was curious about the large amount of audio changes in trunk from .23-fixes and if I needed to re-run my audio setup, as has been suggested in the past |
| [19:46:36] | iamlindoro: | Appears to be necessary for a number of people |
| [19:47:33] | johnnyj: | and the reason i'm trying to look at all these different ERROR's in my logs is that I'm struggling to get more involved |
| [19:47:54] | jayage (jayage!557f0ec9@gateway/web/freenode/ip.85.127.14.201) has joined #mythtv-users | |
| [19:48:58] | jtrag-AWAY (jtrag-AWAY!~jtrageser@c-174-55-74-243.hsd1.pa.comcast.net) has joined #mythtv-users | |
| [19:50:52] | sybolt (sybolt!~sybolt@sybolt.xs4all.nl) has joined #mythtv-users | |
| [19:57:20] | jtrag-AWAY is now known as jtrag | |
| [19:58:09] | Gumby` (Gumby`!~gumby@unaffiliated/gumby) has left #mythtv-users ("Leaving") | |
| [20:01:14] | Gumby (Gumby!~Gumby@unaffiliated/gumby) has quit (Quit: Leaving) | |
| [20:04:11] | jayage (jayage!557f0ec9@gateway/web/freenode/ip.85.127.14.201) has left #mythtv-users () | |
| [20:06:07] | wagnerrp: | Beirdo: im getting a 'ThreadPool:HTTP: thread pool exhausted (max 5 threads)', any suggestions? |
| [20:11:40] | drindt (drindt!~drindt@89.204.137.65) has quit (Quit: Mary had a little Segmentation fault) | |
| [20:12:01] | drindt (drindt!~drindt@89.204.137.65) has joined #mythtv-users | |
| [20:15:48] | SteveGoodey (SteveGoodey!~steve@host81-158-238-21.range81-158.btcentralplus.com) has joined #mythtv-users | |
| [20:17:02] | unixSnob (unixSnob!~unixSnob@starfury.spearlink.com) has joined #mythtv-users | |
| [20:19:00] | marc_us (marc_us!~marc@cpe-24-243-23-106.satx.res.rr.com) has joined #mythtv-users | |
| [20:19:21] | marc_us: | Howdy all. |
| [20:21:00] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has quit (Quit: ...) | |
| [20:23:34] | SteveGoodey (SteveGoodey!~steve@host81-158-238-21.range81-158.btcentralplus.com) has quit (Remote host closed the connection) | |
| [20:26:21] | jamesd2 (jamesd2!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has quit (Read error: Connection reset by peer) | |
| [20:26:54] | jamesd2 (jamesd2!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has joined #mythtv-users | |
| [20:27:13] | rushfan (rushfan!~rushfan@c-71-232-0-154.hsd1.ma.comcast.net) has joined #mythtv-users | |
| [20:34:11] | cesman (cesman!~cecil@pdpc/supporter/professional/cesman) has joined #mythtv-users | |
| [20:40:32] | GadgetWisdomGuru (GadgetWisdomGuru!~gwg@cpe-98-15-241-51.hvc.res.rr.com) has joined #mythtv-users | |
| [20:41:07] | GadgetWisdomGuru (GadgetWisdomGuru!~gwg@cpe-98-15-241-51.hvc.res.rr.com) has left #mythtv-users () | |
| [20:44:37] | Beirdo: | wagnerrp: yes. |
| [20:44:43] | Beirdo: | Increase your pool size :) |
| [20:44:54] | Beirdo: | it's a setting in the db |
| [20:44:58] | wagnerrp: | that a hidden setting? or a complile option? |
| [20:45:03] | wagnerrp: | never seen it in the UI anywhere |
| [20:45:06] | Beirdo: | hidden seting |
| [20:45:15] | christ` (christ`!~Billybob@CPE00e04b0b7799-CM00111a59bdac.cpe.net.cable.rogers.com) has quit (Ping timeout: 265 seconds) | |
| [20:45:24] | wagnerrp: | of source then the other question is why are the threads all in use |
| [20:45:35] | Beirdo: | there is that too |
| [20:45:41] | wagnerrp: | theres no reason why i should already be using 5 HTTP servers |
| [20:45:53] | wagnerrp: | unless they hung at some point |
| [20:45:54] | sphery: | 5 sockets, right? |
| [20:46:03] | Beirdo: | but 5 is a marginal number... one per frontend, mythweb, etc |
| [20:46:05] | sphery: | or 5 connections |
| [20:46:10] | sphery: | maybe not |
| [20:46:15] | Beirdo: | yes, thread workers |
| [20:46:21] | wagnerrp: | five connections, but theyre spawned off into individual threads |
| [20:46:40] | wagnerrp: | but its transient |
| [20:46:50] | wagnerrp: | the connections arent maintained past a single transaction |
| [20:47:06] | wagnerrp: | meaning they should not have a lifetime of more than a few seconds maximum |
| [20:47:15] | sphery: | unless they're serving a recording |
| [20:47:35] | wagnerrp: | sure, but ive got nothing that accesses recordings in that manner |
| [20:47:38] | wagnerrp: | no UPNP systems |
| [20:47:51] | SteveGoodey (SteveGoodey!~steve@host86-153-236-201.range86-153.btcentralplus.com) has joined #mythtv-users | |
| [20:48:04] | sphery: | setting is ThreadPool/HTTP/Max , right? |
| [20:48:23] | drindt (drindt!~drindt@89.204.137.65) has quit (Quit: Mary had a little Segmentation fault) | |
| [20:49:45] | iamlindoro: | Beirdo: I had never seen threadpool exhaustion until the last two weeks, now I occasionally see it and it prevents the BE from doing much of anything |
| [20:49:56] | iamlindoro: | It just spews that message a lot |
| [20:50:06] | iamlindoro: | So something there has recently changed |
| [20:51:52] | iamlindoro: | It feels like something still isn't getting torn down properly |
| [20:53:42] | NightMonkey (NightMonkey!~NightMonk@pdpc/supporter/professional/nightmonkey) has joined #mythtv-users | |
| [20:53:54] | Beirdo: | yeah |
| [20:54:02] | Beirdo: | the server load is increasing |
| [20:54:07] | Beirdo: | and I dunno why |
| [20:54:18] | Beirdo: | and sphery: yes, I believe that's the setting |
| [20:55:15] | Beirdo: | We should look into what all is hitting the server, but it's like apache in a way... the first step is get it working by cranking up the number of threads available :) |
| [20:55:30] | Beirdo: | we'll look into what's keeping them busy at some point too |
| [20:56:16] | Beirdo: | I'm not sure what is using up the connections at this point. I personally set mine to 20 as I do use UPnP, and it eats up connections pretty fast |
| [20:56:58] | Beirdo: | the changes would be on the consumer side, not the server side, AFAICT |
| [20:56:59] | wagnerrp: | the only thing i do that could eat up connections is the backend status page, and upnp |
| [20:57:08] | wagnerrp: | and due to the way my network is set up, upnp is not available |
| [20:57:08] | Beirdo: | i.e. more users of MythXML, SSDP, etc. |
| [20:57:29] | kormoc: | iamlindoro, are you using mythweb during the problem times? |
| [20:57:39] | sphery: | could it be the preview gen hangs + MythWeb preview gen through MythXML |
| [20:57:53] | wagnerrp: | oh! could be the preview gen hanging |
| [20:57:54] | iamlindoro: | kormoc: It becomes apparent to me that it's happened usually when I open the status page, but often it predates that moment |
| [20:57:58] | wagnerrp: | forgot about that |
| [20:58:03] | iamlindoro: | yes, could be that for me also |
| [20:58:06] | Beirdo: | yeah, previewgen may be hitting the server, keeping connections open? |
| [20:58:11] | wagnerrp: | i wouldnt even notice if that were broken |
| [20:58:29] | Beirdo: | well once the previewgen exits, the socket would be closed for sure |
| [20:58:33] | Beirdo: | but if it's hung... |
| [20:58:36] | kormoc: | well |
| [20:58:49] | kormoc: | we're also allowing the browser to control how many requests it uses |
| [20:59:02] | kormoc: | which can be as many as 8 |
| [20:59:07] | Beirdo: | oy :) |
| [20:59:08] | wagnerrp: | Beirdo: which could very well be the case since i were moving files around and they may not have been available to the backend |
| [20:59:42] | Beirdo: | yeah, if the browser wants to use 8 from mythweb pages simultaneously, 5 worker threads is a bit low |
| [21:00:10] | iamlindoro: | Especially if $anything is going on otherwise |
| [21:00:22] | kormoc: | 8 for preview generation + 1 for the master page loading + anything else |
| [21:00:46] | kormoc: | previously when the BE was out of sockets, it'd just hold the inbound connection until one freed up |
| [21:00:49] | kormoc: | so it worked fine |
| [21:00:53] | kormoc: | if that has changed.... |
| [21:01:03] | Beirdo: | it does |
| [21:01:25] | kormoc: | Beirdo, then it wouldn't be complaining about lack of workers |
| [21:01:31] | Beirdo: | but if there are too many things not ever returning and holding up those threads... the backend effectively is wedged |
| [21:01:47] | Beirdo: | oooh, I see what you mean. |
| [21:01:56] | Beirdo: | you mean like in the OS connection queue? |
| [21:01:59] | kormoc: | Yes |
| [21:02:03] | Beirdo: | I don't think I changed that part |
| [21:02:28] | Beirdo: | when I got there, IIRC, all I did was made it actually scream that it had run out, it used to do so silently before |
| [21:02:40] | Beirdo: | it accepts, then blocks waiting for a thread |
| [21:02:54] | Beirdo: | I'd have to go look at it again |
| [21:03:34] | SteveGoodey (SteveGoodey!~steve@host86-153-236-201.range86-153.btcentralplus.com) has quit (Remote host closed the connection) | |
| [21:04:58] | cesman (cesman!~cecil@pdpc/supporter/professional/cesman) has quit (Remote host closed the connection) | |
| [21:05:04] | Beirdo: | we have a max pending connections of 20 |
| [21:05:14] | deegan_____ (deegan_____!~deegan@88.83.55.163) has joined #mythtv-users | |
| [21:06:13] | Beirdo: | but I think with the QTcpServer, not sure it lets us not accept the connection if a condition is set. Not sure |
| [21:07:17] | christ` (christ`!~Billybob@CPE00e04b0b7799-CM00111a59bdac.cpe.net.cable.rogers.com) has joined #mythtv-users | |
| [21:09:05] | deegan____ (deegan____!~deegan@88.83.55.139) has quit (Ping timeout: 276 seconds) | |
| [21:09:15] | jtrag (jtrag!~jtrageser@c-174-55-74-243.hsd1.pa.comcast.net) has quit (Excess Flood) | |
| [21:12:23] | Beirdo: | doesn't seem like it does the way we use it |
| [21:12:53] | Beirdo: | too much buried inside the Qt libraries to be absolutely sure right now |
| [21:13:15] | Beirdo: | we get signalled with incomingConnection(socket) |
| [21:13:30] | Beirdo: | which indicates it's already been accepted, not pending |
| [21:15:17] | sphery: | maybe time to reimplement the http server with QNetworkAccessManager and QNetworkReply instead of QHttp |
| [21:15:27] | sphery: | as in, "This class provides a direct interface to HTTP that allows you to have more control over the requests and that allows you to access the response header fields. However, for new applications, it is recommended to use QNetworkAccessManager and QNetworkReply, as those classes possess a simpler, yet more powerful API." |
| [21:15:32] | sphery: | :) |
| [21:15:42] | Beirdo: | umm |
| [21:15:43] | sphery: | that from http://doc.trolltech.com/4.5/qhttp.html |
| [21:15:55] | Beirdo: | it's using QTcpServer |
| [21:16:01] | Beirdo: | not QHttp for the server |
| [21:16:09] | sphery: | oh |
| [21:16:11] | Beirdo: | now the *clients*, sure :0 |
| [21:17:41] | Beirdo: | it does look like it can be setup to not even accept the connections if there's no thread |
| [21:18:08] | Beirdo: | but it would require some amount of rework, and I'm not comfortable with that for 0.24 |
| [21:18:11] | Beirdo: | after... sure |
| [21:18:47] | kormoc: | it could be that it changed in QT |
| [21:18:50] | deegan_____ (deegan_____!~deegan@88.83.55.163) has quit (Ping timeout: 276 seconds) | |
| [21:18:54] | Beirdo: | that is also possible |
| [21:19:23] | Beirdo: | right now, it seems it will automatically be accepting connections, then signalling us when it has |
| [21:19:23] | unixSnob (unixSnob!~unixSnob@starfury.spearlink.com) has quit (Quit: leaving) | |
| [21:19:28] | kormoc: | iamlindoro, are you on 4.7? |
| [21:19:31] | Beirdo: | which isn't quite what we'd want |
| [21:19:40] | iamlindoro: | kormoc: no, 4.6.3 |
| [21:19:46] | draioch (draioch!~draioch@109.76.31.53) has quit (Quit: draioch) | |
| [21:19:51] | kormoc: | kk, same as I am |
| [21:20:32] | Beirdo: | 4.6.2 here |
| [21:22:14] | Beirdo: | I think if we wanted that behavior, we'd need to create our own loop rather than using the default event loop. But I'm still not 100% sure on how QTcpServer works yet :) |
| [21:25:55] | Guest18431 (Guest18431!~tj@adsl-219-181-180.asm.bellsouth.net) has quit (Remote host closed the connection) | |
| [21:30:55] | deegan_____ (deegan_____!~deegan@88.83.55.139) has joined #mythtv-users | |
| [21:34:20] | Twiggy2cents (Twiggy2cents!~darren@70-41-33-247.cust.wildblue.net) has quit (Read error: Connection reset by peer) | |
| [21:40:56] | johnnyj (johnnyj!~chatzilla@cpe-173-172-31-183.tx.res.rr.com) has quit (Quit: They do expect me to be working) | |
| [21:43:49] | Dave123 (Dave123!~dave@cpe-74-74-222-96.rochester.res.rr.com) has quit (Remote host closed the connection) | |
| [21:45:03] | aa1 (aa1!~aa@74-140-161-197.dhcp.insightbb.com) has joined #mythtv-users | |
| [21:45:23] | deegan______ (deegan______!~deegan@88.83.55.163) has joined #mythtv-users | |
| [21:46:52] | aa1: | Hello, I'm having trouble upgrading from .21 to .23.1, it's telling me that I have to replace utf8 with latin1 in the database backup even tho there is no utf8 in the backup nor is it the default for mysql. anyone feel like helping me prease? :) |
| [21:47:38] | aa1: | afk sec tho |
| [21:49:13] | sphery: | aa1: pastebin the exact (and complete) log output you get from attempting to run mythtv-setup |
| [21:49:23] | deegan_____ (deegan_____!~deegan@88.83.55.139) has quit (Ping timeout: 276 seconds) | |
| [21:49:26] | sphery: | as it never tells you you have to replace utf8 with latin1 |
| [21:49:40] | sphery: | it simply tells you your DB upgrade failed and it may be due to your having a corrupt database |
| [21:50:07] | aa1: | yeah the wiki says that |
| [21:50:08] | otwin (otwin!~na@217.31.78.107) has joined #mythtv-users | |
| [21:50:29] | aa1: | u want me to spam here? |
| [21:50:53] | iamlindoro: | pastebin, not paste |
| [21:51:22] | sphery: | http://mythtv.pastebin.com/ |
| [21:51:33] | aa1: | ah cool |
| [21:53:05] | aa1: | done |
| [21:53:13] | aa1: | :) |
| [21:53:24] | GlemSom (GlemSom!~glemsom@0x5da34bca.cpe.ge-1-1-0-1105.sdnqu1.customer.tele.dk) has quit (Remote host closed the connection) | |
| [21:53:45] | aa1: | had gentoo before, just installed mythbuntu |
| [21:53:53] | aa1: | 10.10 rc |
| [21:54:30] | iamlindoro: | umm... did you want to *share* the pastebin with us? |
| [21:56:18] | sphery: | ah, if you had gentoo before, you will almost definitely need to fix it |
| [21:56:24] | sphery: | but with a link to the pastebin, I can tell you for sure |
| [21:56:45] | kormoc: | We can try our psychic debugging skills! |
| [21:56:53] | ** kormoc sticks a card to his head ** | |
| [21:57:19] | kormoc: | The answer is, you didn't have Latin1 as your mysql use flag! |
| [21:57:26] | sphery: | yep |
| [21:57:35] | sphery: | but it was /not/ misconfigured |
| [21:57:43] | sphery: | obviously |
| [21:57:49] | sphery: | even though it used the wrong configuration |
| [21:57:51] | kormoc: | For realz |
| [21:58:22] | sphery: | (that having nothing to do with aa1--just a reference to old comments) |
| [21:58:25] | kormoc: | I'm amused that I'm the only one that seems to have even bothered to hardcode important things like that |
| [21:58:31] | aa1: | it shows up on the left as a recent post |
| [21:58:34] | messerting (messerting!~messertin@39.79-161-65.customer.lyse.net) has joined #mythtv-users | |
| [21:58:45] | sphery: | aa1: just copy/paste the URI in the address bar of your browser |
| [21:58:46] | aa1: | http://mythtv.pastebin.com/FZjfHfAs |
| [21:58:52] | sphery: | thx |
| [21:59:01] | sphery: | much easier than digging for it |
| [21:59:08] | deegan______ (deegan______!~deegan@88.83.55.163) has quit (Ping timeout: 276 seconds) | |
| [21:59:23] | kormoc: | that's a interesting database name |
| [21:59:38] | iamlindoro: | classy |
| [21:59:48] | aa1: | hmm when i looked at the status of the database before backing it up everything was latin1 |
| [22:00:01] | aa1: | ty |
| [22:00:14] | sphery: | aa1: which Qt version? Out of curiosity |
| [22:00:17] | aa1: | before installing mythbuntu i mean |
| [22:00:37] | kormoc: | aa1, Gentoo had a period where they were flipping on and off the Latin1 use flag, so even if at the end it was correct, data could have went in incorrectly during some periods of time |
| [22:00:53] | aa1: | ah |
| [22:01:09] | aa1: | hmm dont know how to check with ubuntu |
| [22:01:17] | ** sphery presumes the quickest fix for this would be for aa1 to upload the DB backup to http://filebin.ca/ or similar and PM the link to me ** | |
| [22:01:35] | sebrock (sebrock!~sebrock@hd5b90669.selukra.dyn.perspektivbredband.net) has joined #mythtv-users | |
| [22:02:34] | aa1: | k |
| [22:02:36] | aa1: | sec |
| [22:03:49] | streeter (streeter!~streeter@nat/redhat/x-tlkgnvjvacocujks) has quit (Quit: Leaving) | |
| [22:04:54] | sphery: | aa1: ideally, you'll post the pre-upgrade backup that you made on the Gentoo system, not the one made automatically after running some updates and failing |
| [22:05:11] | aa1: | yea |
| [22:05:14] | sphery: | and feel free to post the database anywhere that works for you |
| [22:05:19] | sphery: | if you have your own web server, that's fine |
| [22:05:25] | sphery: | or whatever |
| [22:06:24] | aa1: | http://filebin.ca/ehsuu |
| [22:07:04] | sphery: | small backup |
| [22:08:09] | cdpuk (cdpuk!~chris@91.84.144.76) has quit (Remote host closed the connection) | |
| [22:08:20] | th1 (th1!~th@pdpc/supporter/professional/th1) has left #mythtv-users ("Leaving") | |
| [22:08:35] | sphery: | aa1: OK, I have it, so feel free to tell filebin to delete it |
| [22:10:04] | npm (npm!~npm@cpe-76-169-12-237.socal.res.rr.com) has quit (Remote host closed the connection) | |
| [22:10:56] | deegan______ (deegan______!~deegan@88.83.55.139) has joined #mythtv-users | |
| [22:10:58] | npm (npm!~npm@cpe-76-169-12-237.socal.res.rr.com) has joined #mythtv-users | |
| [22:14:37] | Beirdo: | YAY |
| [22:14:39] | nuonguy (nuonguy!~john@c-24-6-103-14.hsd1.ca.comcast.net) has quit (Quit: Leaving.) | |
| [22:14:43] | Beirdo: | new Good Eats last night |
| [22:16:02] | nuonguy (nuonguy!~john@c-24-6-103-14.hsd1.ca.comcast.net) has joined #mythtv-users | |
| [22:18:26] | dashcloud (dashcloud!~quassel@pool-173-49-209-160.phlapa.fios.verizon.net) has joined #mythtv-users | |
| [22:19:02] | devinheitmueller (devinheitmueller!~devin@c-71-205-242-159.hsd1.mi.comcast.net) has quit (Quit: Leaving.) | |
| [22:19:02] | jamesd2 (jamesd2!~jamesd@adsl-76-229-211-23.dsl.milwwi.sbcglobal.net) has quit (Ping timeout: 240 seconds) | |
| [22:20:40] | jamesd2 (jamesd2!~jamesd@76.229.211.23) has joined #mythtv-users | |
| [22:23:52] | stoth_ (stoth_!~stoth@ool-4572125f.dyn.optonline.net) has joined #mythtv-users | |
| [22:25:59] | backslash7 (backslash7!~backslash@tangocms/supporter/backslash) has joined #mythtv-users | |
| [22:27:21] | backslash7: | hey folks – I'm using an pretty modern mainboard with onboard nvidia graphics with vdpau support. 720p mkv plays relatively fine but 1080p gives me <20fps at 20% cpu load. With mplayer 1080p plays perfectly fine. Why can't xbmc do that and how do I make it do it? |
| [22:28:15] | kormoc: | backslash7, try #xbmc |
| [22:29:01] | backslash7: | oh shit. |
| [22:29:36] | backslash7: | see im so afraid of your strange naming convention (#mythtv and #mythtv-users) that I accidentally your channel! |
| [22:30:00] | backslash7: | kormoc: thanks for your quick hint though :) |
| [22:30:41] | aa1: | sphery: there still or did u go byebye? |
| [22:32:15] | sphery: | yeah, I'm here |
| [22:32:20] | sphery: | working on your DB |
| [22:32:26] | aa1: | yay |
| [22:32:34] | sphery: | trying to decide which approach to use to fix it |
| [22:33:35] | aa1: | what do you mean |
| [22:34:11] | sphery: | long story |
| [22:34:26] | sphery: | I'm just switching to a different system to do it |
| [22:35:40] | Shadow__1 (Shadow__1!~jose@c-76-124-45-124.hsd1.nj.comcast.net) has joined #mythtv-users | |
| [22:39:29] | Shadow__X (Shadow__X!~jose@unaffiliated/shadowx/x-411846) has quit (Ping timeout: 276 seconds) | |
| [22:48:02] | blizzard` (blizzard`!~blizzard@rajraj.nu) has quit (Ping timeout: 264 seconds) | |
| [22:48:33] | blizzard` (blizzard`!~blizzard@rajraj.nu) has joined #mythtv-users | |
| [22:48:56] | inordkuo (inordkuo!~inorkuo@nsc64.16.142-198.newsouth.net) has quit (Quit: Leaving.) | |
| [22:54:35] | jamesd2 (jamesd2!~jamesd@76.229.211.23) has quit (Read error: Connection reset by peer) | |
| [22:55:08] | jamesd2 (jamesd2!~jamesd@76.229.211.23) has joined #mythtv-users | |
| [22:55:51] | jamesd2 (jamesd2!~jamesd@76.229.211.23) has quit (Read error: Connection reset by peer) | |
| [22:58:48] | stoth_ (stoth_!~stoth@ool-4572125f.dyn.optonline.net) has quit (Quit: stoth_) | |
| [22:59:08] | wagnerrp: | sphery: you have any problems with your WD green? |
| [22:59:48] | wagnerrp: | one of mine, my system wont even recognize |
| [23:00:41] | wagnerrp: | windows sees... something, but it doesnt know what |
| [23:01:20] | stoth (stoth!~stoth@ool-4572125f.dyn.optonline.net) has left #mythtv-users () | |
| [23:03:20] | aa1: | WD breaks a lot |
| [23:03:24] | aa1: | :( |
| [23:03:36] | sphery: | wagnerrp: works for me |
| [23:03:53] | wagnerrp: | ive got like 600GB of HDDVD rips id like to be able to recover and not have to rip again |
| [23:03:55] | sphery: | wagnerrp: is it your BSD system that doesn't recognize? |
| [23:04:26] | sphery: | I think the 4kB sectors required driver changes, so they may not be in BSD's |
| [23:04:39] | kormoc: | or in older windows |
| [23:04:50] | wagnerrp: | sphery: no, it used to work fine, and ive got several hundred GB stored to it |
| [23:04:52] | sphery: | yeah, and there's a driver for older windows on WD's website |
| [23:05:14] | wagnerrp: | but i cant get it working after my system funkiness that happened earlier this week |
| [23:05:21] | kormoc: | wagnerrp, swap control boards? |
| [23:05:30] | wagnerrp: | thats what im thinking of doing |
| [23:05:38] | sphery: | aa1: looks like you have the dreaded partial corruption |
| [23:05:43] | wagnerrp: | ive got two identical ones, so depending on the problem, that may work |
| [23:05:45] | sphery: | some is good and some is broken |
| [23:06:09] | waxhead_ (waxhead_!~pete@ppp121-45-221-245.lns20.cbr1.internode.on.net) has joined #mythtv-users | |
| [23:06:31] | aa1: | yeah that sucks |
| [23:06:42] | aa1: | disliking gentoo more now |
| [23:07:12] | kormoc: | it's not Gentoo's fault you didn't check useflag changes and didn't set it to the one you wanted... |
| [23:07:17] | ** wagnerrp has been running his frontends on gentoo for years now ** | |
| [23:07:28] | andreax (andreax!~andreaz@p57B94D5D.dip.t-dialin.net) has quit (Read error: Connection reset by peer) | |
| [23:07:39] | aa1: | whatever |
| [23:08:45] | aa1: | spending a longer amount of time than should be necessary upgrading software is fun |
| [23:09:28] | kormoc: | Gentoo wasn't the right distro for you, as you obviously don't see the benefit in having more control and less structure. |
| [23:09:45] | kormoc: | doesn't mean the distro is at fault |
| [23:09:46] | aa1: | was fun at first, just got tired of it |
| [23:09:57] | aa1: | you don't have to get all defensive |
| [23:10:09] | aa1: | just because I don't like it |
| [23:10:10] | kormoc: | I'm not being defensive |
| [23:10:22] | kormoc: | just pointing out that you're being negative for no reason |
| [23:10:48] | messerting (messerting!~messertin@39.79-161-65.customer.lyse.net) has quit (Ping timeout: 240 seconds) | |
| [23:10:49] | aa1: | all I said was that I dislike gentoo, then you got all negative |
| [23:10:59] | kormoc: | for a reason you caused yourself |
| [23:11:13] | aa1: | and you just had to point it out for what reason? |
| [23:11:23] | sphery: | aa1: I can get you a partial backup that will maintain all your recording info with only minor losses |
| [23:11:24] | kormoc: | you choose to pick a distro that won't hold your hand and then you did something wrong and thus it's the distro's fault? |
| [23:11:36] | sphery: | (and all unimportant losses) |
| [23:11:50] | sphery: | but it means you'll have to reconfigure your systems from scrathc |
| [23:11:54] | sphery: | which is probably not a bad thing |
| [23:12:05] | aa1: | yeah that's cool |
| [23:12:08] | aa1: | I appreciate it :) |
| [23:12:38] | wagnerrp: | if only we ran our own database server and could manage all these settings internally... |
| [23:12:39] | sphery: | I do need to know which Qt version you have, though |
| [23:12:53] | sphery: | if it's 4.6, it will work by truncating some data |
| [23:13:19] | kormoc: | wagnerrp, if only we could agree on a way to slowly migrate to such a setup |
| [23:13:22] | sphery: | on 4.5 and below, you'd get a failure, so I'd have to identify the corrupt rows and fix them individually |
| [23:13:38] | sphery: | anyone know how to ask apt/synaptic/whatever for the Qt version? |
| [23:14:15] | Beirdo: | dpkg -l *qt* should find it :) |
| [23:14:20] | wagnerrp: | kormoc: aye, theres the rub |
| [23:14:37] | aa1: | 4.7 |
| [23:14:48] | aa1: | beirdo: :) |
| [23:14:56] | kormoc: | wagnerrp, I really think we should do a mythproto SQL command |
| [23:14:56] | Beirdo: | more to the point... dpkg -l libqtcore4 |
| [23:15:02] | sphery: | aa1: great... one second, please |
| [23:15:06] | Beirdo: | or apt-cache policy libqtcore4 |
| [23:15:17] | wagnerrp: | kormoc: but even that, we would have to build our own Qt DB frontend |
| [23:15:38] | wagnerrp: | something to translate it into raw SQL calls and send over the backend socket, rather than the database connection |
| [23:15:51] | wagnerrp: | or manually rewrite all those calls directly |
| [23:16:01] | Beirdo: | oooh MythSQL |
| [23:16:01] | Beirdo: | heh |
| [23:16:23] | kormoc: | wagnerrp, just update mythdb to send via proto and expand via proto |
| [23:16:29] | wagnerrp: | in python, i could probably have that running in 1–2 hours |
| [23:16:34] | sphery: | just going to run a Qt 4.6 test to verify it will work for you |
| [23:16:39] | sphery: | booting to a 4.6 system |
| [23:16:43] | kormoc: | wagnerrp, I same with php/perl |
| [23:16:48] | wagnerrp: | ive got much of the code put together already for generating SQL calls for the power recording rules |
| [23:16:55] | wagnerrp: | but Qt... i have no clue |
| [23:18:44] | sphery: | kormoc: if we do a mythproto db command, then we lose all of the separation-between-logical-and-physical-view-of-data benefit of embedding DB and doing up a proper data server |
| [23:18:54] | sphery: | er, mythproto SQL command |
| [23:19:07] | sphery: | i.e. if devs can put raw SQL in, they will |
| [23:19:14] | wagnerrp: | sphery: this would be for a slow migration |
| [23:19:17] | sphery: | then they're writing code that's DB-schema-version-dependent |
| [23:19:27] | kormoc: | sphery, thing is, unless we have a way to handle both, we won't get folks working on migrating to a new system |
| [23:19:32] | wagnerrp: | something to get the database embedded now, and migrate to abstracted data access slowly |
| [23:19:40] | kormoc: | yes |
| [23:19:54] | wagnerrp: | instead of having to do vast change across the code before it works at all |
| [23:19:59] | sphery: | actually, I think it would be easy enough to pull all the SQL out of existing repo code (including plugins) |
| [23:20:30] | sphery: | and provide a mechanism for external plugins to load "data" plugins |
| [23:20:37] | kormoc: | there's *a lot* of missing mythproto calls |
| [23:20:50] | sphery: | right, we wouldn't necessarily need mythproto |
| [23:20:50] | kormoc: | %s/mythproto/mythxml & others/ |
| [23:20:53] | sphery: | just a data proto |
| [23:21:24] | wagnerrp: | i still dont understand how such a thing would be extensible by plugins |
| [23:21:31] | sphery: | anyway, I should probably work on code because it's easiest to see that way |
| [23:21:38] | kormoc: | wagnerrp, the backend would also need to load the plugins |
| [23:21:45] | sphery: | just stuck wasting time on useless stuff like bugs in mythtv-setup |
| [23:22:16] | sphery: | right, the plugins would provide a frontend component (UI stuff) and a backend (technically data server) component |
| [23:22:32] | sphery: | since I hope to also split mythbackend |
| [23:22:42] | sphery: | so you run mythbackend, then it runs the appropriate pieces |
| [23:25:51] | vezza (vezza!~andrea@host80-45-dynamic.17-87-r.retail.telecomitalia.it) has joined #mythtv-users | |
| [23:26:08] | pizzledizzle (pizzledizzle!~pizdets@pool-96-250-215-244.nycmny.fios.verizon.net) has joined #mythtv-users | |
| [23:26:30] | Laughing_Elephan (Laughing_Elephan!~Laughing_@c-71-62-234-137.hsd1.va.comcast.net) has quit (Remote host closed the connection) | |
| [23:27:28] | JJ2 (JJ2!~jjensen@mail.intertech.com) has joined #mythtv-users | |
| [23:29:04] | JJ1 (JJ1!~jjensen@jeffjensen.dsl.visi.com) has quit (Ping timeout: 264 seconds) | |
| [23:30:58] | Captain_Murdoch (Captain_Murdoch!~cpinkham@ip72-218-59-20.hr.hr.cox.net) has quit (Ping timeout: 245 seconds) | |
| [23:32:32] | backslash7 (backslash7!~backslash@tangocms/supporter/backslash) has quit (Quit: leaving) | |
| [23:33:14] | croppa (croppa!~stuart@202-90-54-173.static.linearg.net) has quit (Ping timeout: 272 seconds) | |
| [23:34:22] | cesman (cesman!~cecil@pdpc/supporter/professional/cesman) has joined #mythtv-users | |
| [23:34:34] | wagnerrp (wagnerrp!~wagnerrp_@NR-FT1-66-42-240-159.fuse.net) has quit (Remote host closed the connection) | |
| [23:36:03] | abqjp (abqjp!~abqjp@97-119-165-177.albq.qwest.net) has quit (Quit: abqjp) | |
| [23:40:56] | natanojl (natanojl!~jonatan@c83-252-237-63.bredband.comhem.se) has quit (Ping timeout: 265 seconds) | |
| [23:41:01] | draioch (draioch!~draioch@109.76.31.53) has joined #mythtv-users | |
| [23:41:47] | Twiggy2cents (Twiggy2cents!~darren@66.87.6.231) has joined #mythtv-users | |
| [23:41:55] | croppa (croppa!~stuart@202-90-54-173.static.linearg.net) has joined #mythtv-users | |
| [23:43:07] | kormoc is now known as kormoc_afk | |
| [23:43:51] | Twiggy2cents (Twiggy2cents!~darren@66.87.6.231) has quit (Read error: Connection reset by peer) | |
| [23:45:41] | MavT (MavT!~MaverickT@111.86.233.220.static.exetel.com.au) has joined #mythtv-users | |
| [23:45:45] | wagnerrp (wagnerrp!~wagnerrp_@NR-FT1-66-42-240-159.fuse.net) has joined #mythtv-users | |
| [23:45:45] | Mode for #mythtv-users by ChanServ!ChanServ@services. : +v wagnerrp | |
| [23:46:14] | wagnerrp: | well so much for that plan |
| [23:46:20] | sphery: | aa1: got it. I'll PM the link |
| [23:46:53] | wagnerrp: | i managed to forget that when one plugs in a new drive to an areca card with a degraded array, the card automatically assumes... oh! i bet you want to use that to rebuild onto! |
| [23:46:59] | wagnerrp: | and BAM! no more data |
| [23:47:18] | wagnerrp: | mmm... fun times... |
| [23:47:21] | sphery: | had to manually fix the broken rows--because although our test whether there would be a failure failed to work on Qt 4.6+, the actual conversion also failed to work on Qt 4.6 (i.e. it didn't silently truncate). |
| [23:47:46] | Twiggy2cents (Twiggy2cents!~darren@66.87.6.231) has joined #mythtv-users | |
| [23:48:08] | sphery: | aa1: Do a full restore of that backup file ( http://www.mythtv.org/wiki/Database_Backup_an . . . _backup_file ), then run mythtv-setup to upgrade the database, then reconfigure everything in mythtv-setup |
| [23:48:25] | sphery: | aa1: then start up mythbackend, then start mythfrontend, and reconfigure everything in mythfrontend |
| [23:48:30] | sphery: | aa1: then reconfigure all plugins |
| [23:48:40] | XChatMav (XChatMav!~MaverickT@111.86.233.220.static.exetel.com.au) has quit (Ping timeout: 252 seconds) | |
| [23:48:44] | sphery: | aa1: but on the bright side, all your recording history and existing recordings will be maintained |
| [23:49:02] | ** sphery remembers why he hates partial corruption ** | |
| [23:50:04] | aa1: | that's all that really matters heh |
| [23:50:47] | sphery: | agreed |
| [23:50:55] | sphery: | I'd be lost without my history and existing recordings |
| [23:53:28] | otwin (otwin!~na@217.31.78.107) has left #mythtv-users () | |
| [23:55:18] | stoth (stoth!~stoth@ool-4572125f.dyn.optonline.net) has joined #mythtv-users | |
| [23:56:57] | wagnerrp: | sphery: these things only /retail/ for $120 now |
| [23:57:08] | sphery: | wow |
| [23:57:20] | wagnerrp: | thats how much WD is going to dock my credit card if i dont return the drive in 30 days |
| [23:57:30] | sphery: | didn't WD release their 3TB drive last week or something? |
| [23:57:44] | wagnerrp: | external only |
| [23:57:47] | sphery: | ahh |
| [23:57:59] | sphery: | is it a single-disk external? |
| [23:58:03] | wagnerrp: | they still havent figured how to make >2TB mesh with internal controllers |
| [23:58:06] | wagnerrp: | yeah |
| [23:58:08] | wagnerrp: | USB3 |
| [23:58:22] | sphery: | so it should work fine with Linux drivers, right? |
| [23:58:38] | sphery: | using 4kB sectors |
| [23:58:58] | vezza (vezza!~andrea@host80-45-dynamic.17-87-r.retail.telecomitalia.it) has quit (Quit: Ex-Chat) | |
| [23:59:04] | sphery: | or do the AHCI drivers not circumvent the BIOS... |
| [23:59:11] | wagnerrp: | dont know |
| [23:59:19] | draioch (draioch!~draioch@109.76.31.53) has quit (Read error: Connection reset by peer) | |
| [23:59:48] | sphery: | yeah, I was figuring since the Linux drivers just go direct to the drive since the BIOSes had too many different bugs, it was easiest to go around it |
IRC Logs collected by
BeirdoBot.
Please use the above link to report any bugs.
